Introduction
Strongyloid nematodes of the gastrointestinal tracts of Australian macropodid and vombatid marsupials have undergone extensive diversification (Beveridge et al., Reference Beveridge, Spratt, Johnson, Coulson and Eldridge2010). Currently, there are over 300 described species within 45 genera (Spratt and Beveridge, Reference Spratt and Beveridge2016), with significant numbers of species awaiting formal taxonomic description. Many of these are cryptic (i.e. genetically distinct but morphologically similar) species (e.g. Chilton et al., Reference Chilton, Beveridge and Andrews1993; Beveridge et al., Reference Beveridge, Chilton and Andrews1994; Chilton et al., Reference Chilton, Gasser and Beveridge1995, Reference Chilton, Andrews and Beveridge1996), whereby more than one species has been included under the same specific name (Bickford et al., Reference Bickford, Lohman, Sodhi, Ng, Meier, Winker, Ingram and Das2007). For instance, Hypodontus macropi, which occurs in the caecum and colon of macropodid marsupials, represents a species complex of at least 10 species based on multilocus enzyme electrophoresis (MEE) and DNA sequence data (Chilton et al., Reference Chilton, Beveridge and Andrews1992, Reference Chilton, Gasser and Beveridge1995, Reference Chilton, Jabbar, Huby-Chilton, Jex, Gasser and Beveridge2012). However, none of the species in this complex can currently be distinguished from one another using morphological characters.
The genus Macropostrongyloides belongs within the sub-family Phascolostrongylinae (Lichtenfels, Reference Lichtenfels, Anderson, Chabaud and Willmott1980). Species within this genus are found in macropodid (e.g. kangaroos and wallabies) and vombatid marsupials (i.e. wombats) (Beveridge and Mawson, Reference Beveridge and Mawson1978). Currently, there are five morphologically defined species of Macropostrongyloides, most of which inhabit the caecum and/ or colon of their hosts. The sole exception is Ma. dissimilis which occurs exclusively in the stomach of the swamp wallaby (Wallabia bicolor) (Beveridge and Mawson, Reference Beveridge and Mawson1978). The other species in the genus are Ma. dendrolagi, a parasite of tree kangaroos in Indonesia (Beveridge, Reference Beveridge1997), Ma. lasiorhini which occurs in wombats, Ma. yamagutii, a parasite of western grey kangaroos (Macropus fuliginosus) and occasionally eastern grey kangaroos (Macropus giganteus), and Ma. baylisi, a generalist species that occurs in several macropodid marsupials (Beveridge and Mawson, Reference Beveridge and Mawson1978). However, host usage by Ma. baylisi varies geographically. In northeastern Australia (i.e. Queensland), Ma. baylisi occurs at a high prevalence in the whiptail wallaby, Notamacropus parryi, and the eastern wallaroo, Osphranter robustus robustus (Beveridge et al., Reference Beveridge, Chilton, Johnson, Smales, Speare and Spratt1998), and has been reported from other sympatric hosts, including the antilopine wallaroo, Osphranter antilopinus, the black-stripe wallaby, Notamacropus dorsalis, W. bicolor, and the spectacled hare wallaby, Lagorchestes conspicillatus (Beveridge et al., Reference Beveridge, Speare, Johnson and Spratt1992, Reference Beveridge, Chilton, Johnson, Smales, Speare and Spratt1998). In southern Australia, Ma. baylisi occurs primarily in M. giganteus. Although the geographical range of M. giganteus overlaps with other hosts such as the red-necked wallaby, Notamacropus rufogriseus, M. fuliginosus, W. bicolor and the red kangaroo, O. rufus, only limited host switching has been recorded (Arundel et al., Reference Arundel, Beveridge and Presidente1979; Beveridge et al., Reference Beveridge, Chilton and Andrews1993; Aussavy et al., Reference Aussavy, Bernardin, Corrigan, Hufschmid and Beveridge2011).
Beveridge and Mawson (Reference Beveridge and Mawson1978) hypothesised that Ma. baylisi from M. giganteus may be distinct from Ma. baylisi in O. robustus and N. parryi based on a comparison of morphological characters. This hypothesis was supported by data from a MEE study (Beveridge et al., Reference Beveridge, Chilton and Andrews1993) in which Ma. baylisi from M. giganteus had fixed genetic differences at 33% of loci from Ma. baylisi in O. robustus and N. parryi. However, a formal description of a new species was not undertaken due to insufficient evidence of morphological differences (Beveridge et al., Reference Beveridge, Chilton and Andrews1993). The MEE study also examined the genetic relationships between Ma. baylisi and the morphologically distinct species Ma. yamagutii. The results indicated that Ma. baylisi in M. giganteus was genetically more similar to Ma. yamagutii in M. fuliginosus than to Ma. baylisi in O. robustus and N. parryi (Beveridge et al., Reference Beveridge, Chilton and Andrews1993). The phylogenetic relationships of Ma. baylisi and Ma. yamagutii, and the other species that occur in Australia, Ma. lasiorhini in wombats, and Ma. dissimilis in W. bicolor, have yet to be examined using DNA sequence data.
In the present study, we investigated the genetic variability based on the first and second internal transcribed spacers (ITS-1 and ITS-2, respectively) and the 5.8S gene of the nuclear ribosomal DNA of Ma. baylisi, Ma. yamagutii, Ma. dissimilis and Ma. lasiorhini collected from various hosts throughout Australia. Prevalence data for Ma. baylisi were also examined to better understand its pattern of host-specificity and geographic distribution.
Materials and methods
Sample collection
Adult specimens of Ma. baylisi (n = 68), Ma. yamagutii (n = 19), Ma. dissimilis (n = 5) and Ma. lasiorhini (n = 3) were sourced from the frozen parasite collection at the School of Veterinary Science, The University of Melbourne. These specimens had been collected from culled or road-killed hosts from various localities in Australia (Table 1). Additional specimens of Ma. baylisi from road-killed M. giganteus (n = 1), O. robustus (n = 3), N. parryi (n = 1) and N. rufogriseus (n = 1) were collected in Queensland during September 2018. These nematodes were preserved in 70% ethanol and stored at −80 °C until required for DNA extraction. Individual nematodes were thawed and cut into three segments. The anterior and posterior extremities of each nematode were cleared in lactophenol and mounted on slides for morphological identification. The mid-body segments of each nematode were rinsed in H2O prior to DNA extraction. Voucher morphological specimens representing each ITS+ ( = ITS-1 and ITS-2) sequence genotype have been deposited in the South Australian Museum, Adelaide (SAM 48599–48626). Host nomenclature follows Jackson and Groves (Reference Jackson and Groves2015).
Table 1. Specimens of Macropostrongyloides spp. used in this study. The details of host species, geographic location and GenBank accession numbers of specimens are also provided
Qld, Queensland; NSW, New South Wales; WA, Western Australia; NT, the Northern Territory; SA, South Australia; Vic, Victoria; SAM, South Australian Museum.
Molecular methods
Total genomic DNA (gDNA) was isolated from individual nematodes using the Wizard SV Genomic DNA Purification kit (Promega, Madison, WI, USA). The concentration and purity of each DNA sample were determined spectrophotometrically (ND-1000 UV-VIS spectrophotometer v.3.2.1; NanoDrop Technologies, USA). The ITS+ was amplified by PCR using primers NC16 (5′–AGTTCAATCGCAATGGCTT–3′) and NC2 (5′– TTAGTTTCTTTTCCTCCGCT–3′) (Gasser et al., Reference Gasser, Chilton, Hoste and Beveridge1993; Chilton et al., Reference Chilton, Huby-Chilton and Gasser2003). PCRs were conducted in 50 µL volumes containing 2 µL of DNA template, 10 mm Tris-HCl (pH 8.4), 50 mm KCl (Promega), 3.5 mm MgCl2, 250 µ m of each deoxynucleotide triphosphate (dNTP), 100 pmol of each primer, and 1 U of GoTaq polymerase (Promega). The PCR conditions used were: 94 °C for 5 min, then 35 cycles of 94 °C for 30 s, 55 °C for 20 s, and 72 °C for 20 s, followed by 72 °C for 5 min. Negative (no DNA template) and positive controls (Haemonchus contortus gDNA) were included in the PCR analyses. An aliquot (5 µL) of each amplicon was subjected to agarose gel electrophoresis. Gels (1.5% gels in 0.5 TAE buffer containing 20 mm Tris, 10 mm acetic acid, 0.5 mm EDTA) were stained using GelRed Nucleic Acid Gel Stain (Biotium GelRed stain, Fisher Scientific, Waltham, Massachusetts, USA) and photographed using a gel documenting system (Kodak Gel Logic 1500 Imaging System, Eastman Kodak Company, Rochester, NY, USA).
Amplicons were purified using shrimp alkaline phosphate and exonuclease I prior to automated Sanger DNA sequencing using a 96-capillary 3730xl DNA Analyser (Applied Biosystems, Foster City, CA, USA) at Macrogen Incorporation, South Korea. The ITS+ was sequenced using the primers NC16 and NC2 in separate reactions. The quality of the sequences was appraised using the Geneious R10 software (Biomatters Ltd., Auckland, New Zealand). Polymorphic sites were designated using the International Union of Pure and Applied Chemistry (IUPAC) codes. DNA sequences have been submitted to the GenBank database under the accession numbers MK842122 – MK842147 (Table 1).
Phylogenetic analyses
The ITS+ and 5.8S gene sequences were aligned using the log-expectation (MUSCLE) algorithm in the software MEGA 7.0.26 (Kumar et al., Reference Kumar, Stecher and Tamura2016). Pairwise comparisons of genetic similarity among sequences were determined using Geneious. Given the lack of variability on the 5.8S gene, this fragment was removed from the alignment and excluded from subsequent analysis. Phylogenetic analyses were performed on the aligned ITS+ sequence data using Neighbour-Joining (NJ) and Bayesian Inference (BI) methods. The NJ analysis was conducted using MEGA and nodal support was estimated from 10 000 bootstrap replicates. Bayesian inference analysis was conducted using the Markov Chain Monte Carlo (MCMC) method in the program MrBayes (Ronquist and Huelsenbeck, Reference Ronquist and Huelsenbeck2003). The likelihood parameters set for the BI analysis were based on the Akaike Information Criteria test in jModeltest v.2.1.7 (Guindon and Gascuel, Reference Guindon and Gascuel2003; Darriba et al., Reference Darriba, Taboada, Doallo and Posada2012). The general time-reversible model of evolution, with gamma-distribution and a proportion of invariable sites (GTR + G + I), was utilised for the BI analysis of the sequence data, with nst = 6. Posterior probability (pp) values were calculated by running 10 000 000 generations with four simultaneous tree-building chains (three heated and one cold). Trees were saved every 100th generation. At the end of each run, the standard deviation of split frequencies was <0·01, and the PSRF (Potential Scale Reduction Factor) approached one. For each analysis, a 50%-majority rule consensus tree was constructed based on the final 75% of trees produced by BI. Analyses were run three times to ensure convergence and insensitivity to priors. The ITS+ sequence of Labiostrongylus grandis (GenBank accession no. FR854199), a species within a related sub-family (Cloacininae) was used as the outgroup for the analyses. Tree topology was checked for consensus between NJ and BI analyses using the software Figtree (Rambaut, Reference Rambaut2012).
Results
Molecular characterisation of Macropostrongyloides species
The ITS+ of 93 specimens of Macropostrongyloides was sequenced. Nineteen distinct genotypes were identified in Ma. baylisi, four in Ma. dissimilis, two in Ma. lasiorhini and one in Ma. yamagutii. The lengths of the ITS+ ranged from 773–802 base pairs (bp) in Ma. baylisi, 773 bp in Ma. yamagutii, 782–786 bp in Ma. dissimilis and 775–786 bp in Ma. lasiorhini (Table 2). The ITS-1 sequences were longer than ITS-2 sequences in all species and varied between 383 to 398 bp in Ma. baylisi, 383–385 bp in Ma. lasiorhini, 383 bp in Ma. yamagutii and 392 bp in Ma. dissimilis (Table 2). The length of the ITS-2 varied in Ma. baylisi between 237 to 251 bp but was uniform in M. dissimilis (241 bp), Ma. yamagutii and Ma. lasiorhini (237 bp). The 5.8S gene was 153 bp in length for all specimens and contained no sequence variation except for a transversion (A↔T) at the alignment position 153 in all specimens of Ma. dissimilis (see Supplementary Fig. 1).
Table 2. Characteristics (lengths, G + C contents and variation) of the ITS-1, ITS-2 and ITS+ sequences of Macropostrongyloides specimens from different hosts
a The ITS+ comprises the ITS-1, the 5.8S rRNA gene (153 bp) and the ITS-2
Macropostrongyloides dissimilis was genetically the most distinct species in the genus based on ITS+ sequence variation of 20% between Ma. dissimilis and Ma. baylisi from O. rufus (Table 2). The ITS+ sequences of Ma. yamagutii were more similar to those of Ma. baylisi from O. robustus (sequence variation: 3.3%) than to Ma. baylisi from M. giganteus (2.6%). Specimens of Ma. baylisi showed the highest level of intraspecific variation (Table 2). The ITS+ sequence variation ranged from 0.6 to 9.2%, and the specimens from O. robustus showed the highest variation while those from M. giganteus revealed the least variation (see Supplementary File 1). Intraspecific variation among Ma. dissimilis was slightly greater (2.0%) in specimens from Miles (Queensland) and Kamarooka (Victoria) than that of specimens (0.3%) from Buangor (Victoria). Specimens of Ma. lasiorhini from V. ursinus differed from those collected from L. latifrons by 3.6%. By contrast, specimens of Ma. yamagutii from M. fuliginosus were identical across all localities in South Australia, Victoria and Western Australia, including the specimen from a single M. giganteus from Bourke, New South Wales.
Phylogenetic relationships
The NJ and BI analyses of the ITS+ sequence data resulted in similar tree topologies, hence, only the majority rule consensus tree of the BI analysis of the ITS+ sequences aligned over 824 bp is presented (Fig. 1). The topology of the phylogenetic tree showed that Ma. dissimilis in W. bicolor formed a monophyletic assemblage with total nodal support (i.e. NJ = 100% and BI = 1), and represented the sister taxon to a monophyletic assemblage (with total nodal support) that included all specimens of Ma. baylisi, Ma. yamagutii and Ma. lasiorhini. Specimens of Ma. dissimilis from W. bicolor collected at three localities in Victoria formed a monophlyetic group with strong nodal support (NJ = 99% and BI = 0.8) to the exclusion of the Ma. dissimilis from Miles in Queensland (Fig. 1). In the assemblage containing the three morphologically defined species of Macropostrongyloides, there was no statistical support for Ma. lasiorhini from V. ursinus and L. latifrons representing a monophyletic assemblage. There was no genetic divergence among specimens of Ma. yamagutii from M. fuliginosus in Western Australia, South Australia and Victoria, and M. giganteus in New South Wales. In the phylogenetic tree, Ma. yamagutii represented a sister taxon to Ma. baylisi, in O. robustus and N. parryi; however, there was no statistical support for this relationship.
Fig. 1. Phylogenetic relationships of Macropostrongyloides baylisi, Ma. yamagutii, Ma. lasiorhini and Ma. dissimilis from different hosts and localities. The relationships were inferred based on Bayesian Inference (BI) and Neighbour Joining (NJ) analyses of the concatenated sequences of the first and second internal transcribed spacers. Labiostrongylus grandis was used as the outgroup. Nodal support is indicated by the BI posterior probabilities (pp) followed by NJ bootstrap values. BI pp values below 0.5 and bootstrap values 75% are not shown. The scale bar indicates the number of substitutions per nucleotide site. Qld, Queensland; NSW, New South Wales; WA, Western Australia; NT, the Northern Territory; SA, South Australia; Vic, Victoria; Stn, station; N, north; S, south; E, east; W, west.
Macropostrongyloides baylisi was not a monophyletic assemblage, but represented four genetically distinct clades, each with total statistical support (NJ = 100% and BI = 1.0) (Fig. 1). The first clade comprised specimens of Ma. baylisi collected from O. r. woodwardi, O. r. erubescens and the purple-necked rock wallaby, Petrogale purpureicollis. The second clade primarily contained specimens of Ma. baylisi from M. giganteus from multiple localities in eastern Australia (Victoria, New South Wales and Queensland), M. fuliginosus from Nyngan (New South Wales), O. rufus from Werribee Zoo (Victoria) and N. rufogriseus from Omanama (Queensland). The third clade contained exclusively specimens of Ma. baylisi from O. rufus collected from Kalgoorlie (Western Australia). The fourth and largest clade consisted of specimens of Ma. baylisi in O. r. erubescens, O. r. robustus, O. antilopinus, N. parryi and N. dorsalis (Fig. 1). This clade is divided into three groups, which are partially based on host species or subspecies, and the localities from which they were collected.
The geographical distribution of the four clades of Ma. baylisi is shown in Fig. 2. Clade 4 was the most widely distributed with genotypes occurring in all states except Victoria and Tasmania. Clade 2, containing specimens from M. giganteus, was restricted to Victoria and New South Wales, except for one specimen from Omanama, in southeastern Queensland. There were several localities at which more than one genotypes of Ma. baylisi was present and these included Kalgoorlie (Western Australia), Greymare and Cloncurry (Queensland).
Fig. 2. Map showing the distribution of Macropostrongyloides baylisi and each of the four Ma. baylisi clades based on the phylogenetic analysis. Clade 1 is represented by closed circles, clade 2 is indicated by closed triangles, clade 3 is depicted by a closed star, and clade 4 is shown by open circles. The distribution of O. robustus is shaded in dark grey and the distribution of M. giganteus is shaded in light grey bordered by a dotted line.
Prevalence and distribution of Ma. baylisi
The prevalence of Ma. baylisi in different hosts and geographic regions was compiled from unpublished and published records dating back to 1979 (Table 3). The host range of Ma. baylisi is limited to the family Macropodidae; it has not been recorded from members of the Potoroidae, Hypsiprymnodontidae or Vombatidae (Beveridge et al., Reference Beveridge, Speare, Johnson and Spratt1992). The prevalence of Ma. baylisi within macropodid marsupials varied between different host genera and geographic regions. In Queensland, the highest prevalence of Ma. baylisi recorded was in N. parryi (76%) and O. antilopinus (64%). Other sympatric hosts examined, including N. dorsalis, the bridled nail-tail wallaby, Onychogalea fraenata and L. conspicillatus, were infected by Ma. baylisi, but at a lower prevalence (Table 3). Among the rock wallabies examined (genus Petrogale), P. purpureicollis was the only species in which one animal was infected with Ma. baylisi. Macropostrongyloides baylisi was present throughout the distribution of O. robustus (Fig. 2) and the prevalence was highest in New South Wales (Table 3). Although M. giganteus is distributed throughout most of eastern Queensland (Fig. 2), the prevalence of Ma. baylisi in Queensland was only 19% (unpublished data). The prevalence of 38% recorded by Beveridge and Arundel (Reference Beveridge and Arundel1979) was based on data from New South Wales and Victoria combined, and therefore it was not possible to determine the prevalence in each state. Macropostrongyloides baylisi has been encountered most commonly in M. giganteus in Victoria and New South Wales (Table 3).
Table 3. Prevalence of Macropostrongyloides baylisi in macropodid hosts reported in published and unpublished surveys
Qld, Queensland; NSW, New South Wales; WA, Western Australia; NT, the Northern Territory; SA, South Australia; Vic, Victoria; SAM, South Australian Museum.
a Includes data from earlier publications.
b Erroneously cited as 25% in paper.
Discussion
Analyses of the ITS+ sequences of four morphologically defined species of Macropostrongyloides in Australia revealed considerable genetic variation within three species: Ma. baylisi, Ma. lasiorhini and Ma. dissimilis. However, there was no genetic variation in ITS+ sequences in Ma. yamagutii collected from hosts across its broad geographical range. The primary host of Ma. yamagutii is M. fuliginosus. However, this nematode is also capable of infecting M. giganteus sharing the same habitat (Aussavy et al., Reference Aussavy, Bernardin, Corrigan, Hufschmid and Beveridge2011). Furthermore, M. fuliginosus is a genetically variable host, with four genetically distinct populations inhabiting different geographical regions (Neaves et al., Reference Neaves, Zenger, Prince, Eldridge and Cooper2009). Therefore, it is surprising that no genetic divergence was detected in Ma. yamagutii from different host populations.
In contrast, there was extensive genetic variation within Ma. baylisi. The phylogenetic analyses showed that this nematode species did not represent a monophyletic assemblage. There were four well-supported clades within Ma. baylisi. This finding provides further support to previous studies proposing the hypothesis that Ma. baylisi represents a species complex (Beveridge and Mawson, Reference Beveridge and Mawson1978; Beveridge et al., Reference Beveridge, Chilton and Andrews1993). The genetic differences detected between Ma. baylisi from M. giganteus and those in O. robustus and N. parryi were consistent with previous MEE data (Beveridge et al., Reference Beveridge, Chilton and Andrews1993). Clade 1, which comprised specimens of Ma. baylisi from O. r. erubescens, O. r. woodwardi and P. purpureicollis, was genetically the most distinct from the other three clades of Ma. baylisi. The presence of Ma. baylisi from O. r. woodwardi in clade 1 is consistent with the distinctive morphological variation detected in Ma. baylisi from the same host in the Kimberley Region of Western Australia (Beveridge et al., Reference Beveridge, Chilton and Andrews1993). However, additional material from O. r. woodwardi is required to determine whether there is genetic variation among Ma. baylisi in this host. The specimens of Ma. baylisi from O. r. erubescens collected near Cloncurry, Queensland, appear to represent a case of host switching from O. r. woodwardi since other sequences from O. r. erubescens in other locations were placed in two subgroups within clade 4 (Fig. 1). This could be due to the lack of clear geographical separation between the two subspecies of wallaroo in northeastern Queensland (Clancy and Croft, Reference Clancy, Croft, Van Dyck and Strahan2008) therefore allowing genetically distinct populations of nematodes to switch between these hosts. The inclusion of the specimen from P. purpureicollis in this clade is most likely due to host switching from O. r. erubescens. Petrogale purpureicollis is not a usual host for Ma. baylisi as sampling has found only one specimen in P. purpureicollis, and no specimens have been found in any of the other Petrogale species (Beveridge et al., Reference Beveridge, Spratt, Close, Barker and Sharman1989). It is known that the habitats used by O. r. erubescens and P. purpureicollis in north-western Queensland overlap and as a consequence these two host species share many parasitic helminths (Bradley et al., Reference Bradley, Beveridge, Chilton and Johnson2000).
Host switching was also present within the second clade of M. baylisi which contained primarily specimens from M. giganteus. Also included in this clade were specimens of M. baylisi from three host species (i.e. O. rufus, M. fuliginosus and N. rufogriseus,) that have overlapping ranges with M. giganteus (Van Dyck and Strahan, Reference Van Dyck and Strahan2008). The specimen of Ma. baylisi from O. rufus at Werribee Park Zoo had the same ITS+ sequence as the majority of specimens from M. giganteus indicating the nematode's capacity to infect distantly related hosts under captive conditions. The specimens of Ma. baylisi found in N. rufogriseus at two collection localities in south-east Queensland near Greymare represent a new host record. Previous studies have not detected the presence of Ma. baylisi in N. rufogriseus despite extensive sampling of this host species at localities where Ma. baylisi occurs in M. giganteus at a high prevalence (Aussavy et al., Reference Aussavy, Bernardin, Corrigan, Hufschmid and Beveridge2011). Of significance, one nematode in N. rufogriseus belonged to clade 2 ( = Ma. baylisi in M. giganteus), while the second nematode had an ITS+ sequence identical to that of some Ma. baylisi in O. r. robustus and O. r. erubescens ( = Clade 4).
The third clade consisted of Ma. baylisi found only in O. rufus from Kalgoorlie, Western Australia. There are records of Ma. baylisi infecting O. rufus in South Australia and New South Wales (Table 3); however, no material was available from these geographical areas for molecular analysis. Additional sampling of Ma. baylisi from O. rufus in other localities, particularly in areas of sympatry with other hosts species is required to define the true geographic distribution of this genotype in O. rufus. Nonetheless, the nematodes in O. rufus (clade 3) represent a genetically distinct group within the Ma. baylisi complex and they were collected in sympatry (i.e. at Kalgoorlie in Western Australia) with Ma. baylisi in O. r. erubescens (i.e. clade 4).
Clade 4 comprised Ma. baylisi collected from O. r. erubescens, O. r. robustus, O. antilopinus, N. parryi and N. dorsalis. This clade contains four groups of specimens which correspond to some extent to different host species or subspecies of O. robustus, and geographical locality. The clustering of specimens from O. r. erubescens from various localities into one group distinct from those in O. r. robustus, together with the occurrence of specimens from O. r. woodwardi in a completely separate clade suggests that host subspecies may have some influence over genetic divergence in Ma. baylisi. However, specimens from O. r. erubescens in Alice Springs share the same ITS+ sequence as those from O. r. robustus in Queensland and New South Wales which complicates this hypothesis. Additional samples are required to determine whether two genetically distinct populations of Ma. baylisi are present in O. r. erubescens. The group comprising specimens from O. r. robustus, O. antilopinus, N. parryi and N. dorsalis was consistent with the MEE findings from Beveridge et al. (Reference Beveridge, Chilton and Andrews1993). The similarities in the genetic sequences of Ma. baylisi shared by these different hosts is most likely due to the overlapping of habitats and instances of host switching (Beveridge et al., Reference Beveridge, Chilton, Johnson, Smales, Speare and Spratt1998).
The genetic distinction between Ma. lasiorhini from two species of vombatid marsupials, V. ursinus and L. latifrons, suggests that this nematode may also represent two host-specific species. However, this requires further examination. Nonetheless, it is interesting to note that the prevalence of Ma. lasiorhini differs between the two hosts, with a significantly higher prevalence in L. latifrons than in V. ursinus (Beveridge and Mawson, Reference Beveridge and Mawson1978 and unpublished observations).
Genetic variation in ITS+ sequences was detected between specimens of Ma. dissimilis from Queensland and Victoria, located 1,600 km apart. Although the distribution of W. bicolor is continuous along the east coast of Australia (Merchant, Reference Merchant, Van Dyck and Strahan2008), the results of the present study indicate genetic differences between the northern and southern population of Ma. dissimilis. This geographical pattern of genetic divergence is consistent with that detected previously for two other parasites of W. bicolor; the intestinal nematode, H. macropi (Chilton et al., Reference Chilton, Jabbar, Huby-Chilton, Jex, Gasser and Beveridge2012), and a bile-duct cestode Progamotaenia festiva (Beveridge et al., Reference Beveridge, Shamsi, Hu, Chilton and Gasser2007). However, population genetic inferences cannot be made without additional sampling from this host in the intermediate localities.
The results of the phylogenetic analyses of ITS+ data showed that Ma. dissimilis is the sister taxon to all other Australian species of Macropostrongyloides. Specimens of the fifth species, Ma. dendrolagi, a parasite that occurs in the colon of tree kangaroos in Indonesia (Beveridge, Reference Beveridge1997), were not available for inclusion in this study. The phylogenetic relationship of Ma. dissimilis is interesting because it is the only member of the genus that occurs in the stomach of its hosts (Beveridge and Mawson, Reference Beveridge and Mawson1978). Moreover, the morphology of the vagina of Ma. dissimilis is distinct from congeners. The vagina in this nematode species is J-shaped or Type-2 of Lichtenfels (Reference Lichtenfels, Anderson, Chabaud and Willmott1980), whereas the vagina in Ma. baylisi, Ma. yamagutii, Ma. lasiorhini and Ma. dendrolagi is Y-shaped or Type-1 (Beveridge and Mawson, Reference Beveridge and Mawson1978; Beveridge, Reference Beveridge1997). This morphological difference between female nematodes suggests that Ma. dissimilis may be more closely related to the cloacinine stomach-inhabiting nematodes, which also have a Type-2 ovejector, and may have more recently colonised the stomach (Beveridge, Reference Beveridge1987). However, this hypothesis requires testing using morphological and molecular characterisation of a larger number of specimens. Furthermore, phylogenetic inferences based on a single molecular marker such as ITS represent molecular prospecting and are insufficient to delineate a species or fully explain speciation processes (Nadler and Pérez-Ponce de León, Reference Nadler and Pérez-Ponce de León2011). In addition, the ITS region has shown contrasting evolutionary patterns in some plant parasitic nematodes (Pereira and Baldwin et al., Reference Pereira and Baldwin2016). Such questions could be addressed by the characterisation of the mitochondrial genome which has been found to accumulate mutations more rapidly compared to the nuclear genome. Mitochondrial genome sequence data have been used to investigate the population genetics and systematics of nematodes (Hu et al., Reference Hu, Chilton and Gasser2003). Molecular investigations involving characterisation of the ITS nuclear DNA sequence (Chilton et al., Reference Chilton, Jabbar, Huby-Chilton, Jex, Gasser and Beveridge2012) and the amino acid sequence of the mitochondrial genome to validate the presence of three genetically distinct groups within H. macropi (Jabbar et al., Reference Jabbar, Beveridge, Mohandas, Chilton, Littlewood, Jex and Gasser2013) suggests that such an approach might also be applied to Macropostrongyloides spp., thereby helping to resolve discrepancies found between electrophoretic and ITS datasets.
In conclusion, the separation of Ma. baylisi into four genetically distinct clades based on phylogenetic analyses of ITS+ sequence data provides additional support for the hypothesis that Ma. baylisi represents a species complex. Macropostrongyloides lasiorhini may also represent two genetically distinct species, while there is genetic divergence between Ma. dissimilis from different geographical areas. These findings represent an important contribution to document the diversity of Australian parasitic nematodes. They also highlight the need for future studies into the comprehensive molecular analysis of these nematodes to better understand the evolutionary processes leading to their existence.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0031182019001008.
Acknowledgements
We wish to thank numerous colleagues who helped with the collection of specimens, including R.H. Andrews, B.J. Coman, A.J. Doube, P. Holz, J. Hufschmid, J. Jackson, P.M. Johnson, S. Middleton, L.R. Smales, R. Speare and L. White.
Financial support
Funding was provided by the Australian Biological Resources Study grant numbers RF217-06 and CBG18-07.
Conflict of interest
The authors declare that they have no competing interests.
Ethical standards
Specimens were collected under the following state-issued permits: Victorian Department of Sustainability and Environment 90-053, 93-016, 10000434, 100003649; Queensland National Parks and Wildlife Service T00436, T1131, Queensland Department of Environment and Heritage Protection WA 00006125, the Northern territory Department of Primary Industry 15747, the Western Australian Department of Environment and Conservation SF007407 and the South Australian Department of Environment and Heritage EO7358.
