Introduction
Tuberculosis (TB), one of the most wide-spread infectious diseases, poses a great threat to human health (Young et al., Reference Young, Perkins, Duncan and Barry2008). TB causes an estimated 8 million people infections each year, and more than 2 million deaths annually (Raviglione, Reference Raviglione2003). In 2005, an estimated 8.8 million TB cases occurred, in which 3.9 million people tested were smear-positive and about 1.6 million individuals died (World Health Organization. 2009). Only about 10% of those infected developed clinically manifested tuberculosis (Raviglione, Reference Raviglione2003). Genetic variation within host populations is known to be signficant in humans and animals (Bellamy et al., Reference Bellamy, Beyers, McAdam, Ruwende, Gie, Samaai, Bester, Meyer, Corrah, Collin, Camidge, Wilkinson, Helden, Whittle, Amos, van Helden and Hill2000; Casanova & Abel, Reference Casanova and Abel2002). Genetic approaches have been used successfully to map and isolate host resistance genes in plants (Staskawicz et al., Reference Staskawicz, Mudgett, Dangl and Galan2001), insects (Poirie et al., Reference Poirie, Frey, Hita, Huguet, Lemeunier, Periquet and Carton2000) and vertebrates (Lee et al., Reference Lee, Girard, Macina, Busà, Zafer, Belouchi, Gros and Vidal2001), but the nature of the genetic control of host resistance to tuberculosis remains poorly understood. Previously, Kramnik et al. (Reference Kramnik, Dietrich, Demant and Bloom2000) mapped a new genetic locus on mouse chromosome 1, designated sst1 (super-susceptibility to tuberculosis 1). Pan and colleagues (Reference Pan, Yan, Rojas, Shebzukhov, Zhou, Kobzik, Higgins, Daly, Bloom and Kramnik2005) showed that this locus mediated innate immunity to TB in an sst1 congenic mouse strain and identified a candidate gene Ipr1, which is expressed highly in the macrophages of sst1-resistant mice and expressed at low levels in susceptible mice. The Ipr1 gene participated in the control of intracellular multiplication of virulent MTB and effected cell death mechanisms of the infected macrophages. Cattle are susceptible to TB, and bovine TB is zoonotic, it causes heavy losses to agriculture and to human health (Thoen et al., Reference Thoen, LoBue and de Kantor2006). The control of bovine TB has always been an important issue in the cattle breeding industry. Transgenic technology is an important strategy to enhance the resistance of animal disease, in order to investigate the control of bovine TB, in this study the Ipr1 gene was introduced into bovine fetal fibroblasts to produce Ipr1-transgenic embryos. This study will provide valuable information for the future production of Ipr1-transgenic cattle.
Materials and methods
Construction of the Ipr1-specific expression vector
Total RNA was isolated from the lung of C57 BL/6J mice (Experimental Animal Center of Xi'an Jiaotong University) in accordance with manufacturer's instructions using the SV Total RNA Isolation System (Promega). cDNA was obtained according to specifications given in RevertAid™ First Strand cDNA Synthesis Kits (Fermentas). Ipr1 was amplified using the following primers and sequences, Ipr1-f: AGGAACCCCTTAACTAATCCAGGCA, Ipr1-r: GCTGGGACACTCAGAGGCTCAAAG. Polymerase chain reaction (PCR) conditions were as follows: 94°C for 5 min, 30 cycles of 94°C for 30s, 64°C for 30s, and 72°C for 2 min, 72°C for 10 min. PCR products were resolved on 0.8% agarose gels, purified PCR products were cloned into the pMD18-T Vector (TaKaRa) and the construct named pIpr1. Then, pIpr1 was digested with EcoRI and PstI restriction enzymes, and subsequently inserted into plasmid pEGFP-C1 (Clontech), and named pEGFP-C1-Ipr1.
The macrophage-specific promoter Sp was amplified from pSP-GFP (a gift from Dr Wen, Affiliated Hospital of Chongqing Medical College). Primer SpS contained a BglII recognition site (underlined) in the 5′-terminal end and two TAA stop codon (bold) to avoid forming fusion proteins with eGFP gene, and primer SpA contained a EcoRI recognition site in the 5′-terminal end (underlined). SpS: GAAGATCTTAATAAAAGCGACTTCCTCTTTCCA-GCAGAAAAGGA, SpA: CGGAATTCGCTAGCGAC-TGGGTGGCCTCCAGTGCTCCC. Then, SP was digested with BglII and EcoRI enzymes, purified and cloned into pEGFP-C1-Ipr1, named pSP-EGFP-Ipr1
Preparation of donor cells
Bovine fetal fibroblasts were thawed and seeded into 60-mm cell culture dishes, and incubated in Dulbecco's modified Eagle's medium (DMEM; HyClone) containing 10% fetal calf serum (Gibco) at 37°C in 5% CO2 in air. The fifth passage cells were transfected with pSP–EGFP–Ipr1 (20 μg) by electroporation. After 24 h, expression of eGFP in the cells was monitored under ultraviolet light (B-mode filter, Nikon). After selection with 600 μg/ml gentamycin (G418) for 14 days, then the cells that expressed eGFP were picked and expanded. Transgenic cells were cultured for 3 days in DMEM supplemented with 0.5% fetal bovine serum (FBS) prior to somatic cell nuclear transfer (SCNT) and individual cells were retrieved from the monolayer by trypsinization for 2 min. Non-transfected fibroblasts were used as control.
Flow cytometric analysis
Karyotype analysis of the transgenic positive cells was performed by flow cytometry.
Identification by PCR
Genomic DNA from screened positive cells was extracted and then was used as templates for PCR analysis.
Maturation of immature oocytes in vitro
Bovine ovaries were collected from a local slaughterhouse, and were transported to the laboratory within 6 h in a 0.9% (v/v) NaCl solution that contained 1% (v/v) penicillin/streptomycin (10000 U/ml penicillin G, 10000 μg/ml streptomycin) at 30–37°C. Cumulus–oocyte complexes (COCs) were aspirated using 10-ml sterilized disposable syringe. COCs were washed in DPBS solution thrice and cultured in prebalanced M199 solution (TCM-199, Life Technologies). Then 30 COCs were cultured in 400 μl maturation medium covered with 350 μl mineral oil at 38.5°C 5% CO2 saturated humidity for 22–24 h.
Nuclear transfer
The procedure of enucleated of oocytes, injection of donor cells, fusion of reconstructed embryos and culture of cloned embryos were carried out according to the methods in our laboratory (Hua et al., Reference Hua, Zhang, Song, Song, Zhang, Zhang, Zhang, Cao and Ma2008).
Statistical analysis
In order to investigate the developmental competence of transgenic cloned embryos, fusion, cleavage and blastocyst formation rates of reconstructed embryos were analysed using the chi-squared test. Embryos were allocated randomly to each experimental group and the experiments were replicated at least 10 times.
Results
Construction of the Ipr1 expression vector
As shown in Figure 1, the vector was digested by EcoRI and PstI enzymes and the plasmid pIpr1 was cut into 2692-bp and 1614-bp fragments, the purified Ipr1 fragment was inserted into pMD18-T Vector correctly. The macrophage-specific promoter Sp was present, as shown in Figure 2. Digestion with BglII and EcoRI enzymes yielded 4.7 + 1.9-kb fragments for pSP-EGFP-Ipr1 (Fig. 3).
Figure 1 The restriction endonuclease double digestion of pIpr1. Lanes: A, pIpr1 was digested with EcoRI and PstI; M, DNA marker VII (TIANGEN).
Figure 2 Polymerase chain reaction product of Sp. Lanes: M, DNA marker I (TIANGEN); A, PCR amplification using the primers (SpS, SpA).
Figure 3 The restriction endonuclease double digestion of pSP–EGFP–Ipr1. Lanes: A, pSP–EGFP–Ipr1 was identified by restriction enzymes BglII and BamHI; M, DNA marker III (TIANGEN).
The expression of the eGFP gene in transgenic cell clones
Fibroblast cells were transfected with pSP-EGFP-Ipr1, then after 24 h transfection, through G418 selection, the monoclonal cells were picked and transferred into a 24-well plate, Figure 4 showed that eGFP could be expressed in transgenic cells, indicating that the foreign vector had integrated into the cell genome.
Figure 4 Expression of the eGFP gene in G418-resistant cells.
Karyotype analysis of donor cells
The result of flow cytometry showed that the positive cell clones had normal chromosome numbers and integrity (Fig. 5), suggesting that these transgenic cell clones may be competent as donor cells for creating transgenic cattle by SCNT.
Figure 5 Karyotype analysis of donor cells by flow cytometry.
Detection of donor cells by PCR
Genomic DNA from positive cells was extracted and then used as the template for PCR analysis, with the 1614-bp fragment of interest obtained (Fig. 6). However, no fragment of interest was amplified using genomic DNA from non-transgenic cells, establishing the integration of the gene of interest into the cell genome.
Figure 6 Detection of donor cells by polymerase chain reaction (PCR). Lane: M, DNA marker VII; A, PCR product of positive cells; B, PCR product of negative cells.
Development of SCNT embryos in vitro
A total number of 120 bovine oocytes was successfully enucleated and 60 oocytes were fused with transgenic fibroblasts, the remaining 60 oocytes were fused with non-transgenic fibroblasts. The development of somatic cell cloned embryos between transgenic cells and non-transgenic cells were compared. As shown in Table 1, there was no significant difference (P > 0.05) in fusion (71.7 vs. 75.0%) and cleavage rates (81.4 vs. 84.5%) between the two cell groups. While the blastocyst formation rate was significantly difference (18.6 vs. 31.1%, P < 0.05).
Table 1 In vitro development of bovine somatic cloned embryos
a,bValues for individual different letters in the same column are significantly different (P < 0.05).
Discussion
Commercial vaccines such as bacillus Calmette-Guérin and tuberculosis DNA vaccines are available for humans for the prevention and cure of tuberculosis, but not for bovine. The only way to control bovine TB is to strengthen quarantine, such that the tuberculosis-positive cattle are slaughtered. At present, cure of bovine TB can only be performed by using antibiotics, for instance, streptomycin and kanamycin. However, use of antibiotics in the long term could trigger bacterial drug resistance, so effective programmes for prevention and eradication bovine TB are needed.
Somatic cell nuclear transfer has provided an alternative efficient way for the production of transgenic animals (Wilmut et al., Reference Wilmut, Schnieke, McWhir, Kind and Campbell1997; Park et al., Reference Park, Lai, Cheong, Cabot, Sun, Wu, Rucker, Durtschi, Bonk, Samuel, Rieke, Day, Murphy, Carter and Prather2002). Various cell types have been used as donor cells to produce viable offspring (Hochedlinger & Jaenisch, Reference Hochedlinger and Jaenisch2006; Campbell et al., Reference Campbell, Fisher, Chen, Choi, Kelly, Lee and Xhu2007). Compared with other cells, fibroblast cells are easily obtained and have been extensively used as donor cells for producing transgenic animals (Schnieke et al., Reference Schnieke, Kind, Ritchie, Mycock, Scott, Ritchie, Wilmut, Colman and Campbell1997). Moreover, many transgenic animals have been successfully generated using fetal fibroblasts (Cibelli et al., Reference Cibelli, Stice, Golukr, Kane, Jerry, Blackwell, de León and Robl1998; McCreath et al., Reference McCreath, Howcroft, Campbell, Colman, Schnieke and Kind2000; Lai et al., Reference Lai, Kolber-Simonds, Park, Cheng and Greenstein2002); furthermore fibroblast cells have been shown to produce clones with higher efficiency after SCNT than for other cells (Liu et al., Reference Liu, Zhang, Zheng, Zhao, Zhang, Wang, Wang, Quan and An2007). Thus, transgenic bovine fetal fibroblasts were stably selected for donor cells in our experiments.
Green fluorescent protein (GFP) reporter gene is easily detected, GFP selection of donor cells has been used to produce transgenic offspring in mice (Kato et al., Reference Kato, Yamanouchi, Ikawa, Okabe, Naito and Tojo1999; Sato et al., Reference Sato, Hosaka, Ohkawa, Tokieda and Ishiwata2001), and pigs (Park et al, Reference Park, Lai, Cheong, Cabot, Sun, Wu, Rucker, Durtschi, Bonk, Samuel, Rieke, Day, Murphy, Carter and Prather2002). In order to produce transgenic cloned cattle by SCNT, in the present study, a GFP reporter system was employed to select donor cells with a transgene. Furthermore, transgenic cloned embryos could also be observed by eGFP fluorescence detection (Fig. 7), which could further improve the efficiency of production of transgenic cloning.
Figure 7 Transgenic cloned embryos could be observed under a fluorescence microscope.
Direct evidence that Ipr1 mediates innate immunity to MTB has been reported (pan et al., Reference Pan, Yan, Rojas, Shebzukhov, Zhou, Kobzik, Higgins, Daly, Bloom and Kramnik2005), which provided a new strategy for anti-tuberculosis research. Considering that the Ipr1 gene is expressed in macrophage cells, we have generated transgenic bovine fetal fibroblasts that integrated Ipr1 cDNA under the control of the macrophage-specific Sp promoter. After fluorescence observation, karyotype analysis and the developmental potential analysis in vitro, results showed that the positive cells obtained from this study could be used as donor cells for nuclear transfer for the production of transgenic animals. This paper constitutes the basis for further production of anti-tuberculosis Ipr1-transgenic cattle.
Acknowledgements
We thank Dr Yongsheng Wang and Dr Fusheng Quan for their assistance during this research and critical comment. This study was supported by a key special project of breeding for disease resistance of People's Republic of China (Project no. 2008ZX08007–004).
