INTRODUCTION
Neospora caninum is an Apicomplexan protozoan that was isolated in 1988 by Dubey and collaborators when investigating the origin of a severe neuromuscular disorder in dogs. The disease was first described in dogs in 1984, in sheep in 1987 and was correlated to economical losses in cattle in 1988 (Dubey et al. Reference Dubey, Hattel, Lindsay and Topper1988). Due to morphological and biochemical similarities between N. caninum and Toxoplasma gondii, and the fact that both life cycles involve 2 types of host with similar kinetics, the first cases of neosporosis could have been misdiagnosed as toxoplasmosis (Hemphill et al. Reference Hemphill, Vonlaufen and Naguleswaran2006). N. caninum has been detected in definitive and/or intermediate hosts in almost all continents (Dubey et al. Reference Dubey, Schares and Ortega-Mora2007), and it is now known that dogs and coyotes are definitive hosts and cattle are economically the most relevant intermediate hosts.
As all other Apicomplexa, N. caninum is an obligatory intracellular parasite and invades the host cells by a conserved and extremely successful mechanism. The host cell invasion process occurs via a parasite-driven mechanism known to be an active invasion (Cesbron-Delauw et al. Reference Cesbron-Delauw, Gendrin, Travier, Ruffiot and Mercier2008), requiring the use of its own actin/myosin motor-system (Daher and Soldati-Favre, Reference Daher and Soldati-Favre2009). The multi-factorial process of invasion involves receptors related to the recognition, gliding and invasion. Receptors are constituted by a set of proteins released by micronemes, rhoptries and dense granules. Micronemes are organelles containing a concentrated mixture of adhesive proteins released to enable parasite invasion (Friedrich et al. Reference Friedrich, Santos, Liu, Palma, Leon, Saouros, Kiso, Blackman, Matthews, Feizi and Soldati-Favre2010). They possess modules homologous to adhesive domains of higher eukaryotes that have been demonstrated to act in the direct binding to host cells (DiCristina et al. Reference Di Cristina, Spaccapelo, Soldati, Bistoni and Crisanti2000). These motifs are present in one or multiple copies in micronemal proteins and a large number of combinations of these blocks have been described, making each micronemal protein structurally unique, which increases their invasion capacity (Soldati et al. Reference Soldati, Dubremetz and Lebrun2001).
Among Apicomplexans, a highly conserved family of microneme proteins is the thrombospondin-related anonymous protein (TRAP). A range of different denominations have been described, there are members of TRAP in Plasmodium sporozoite (TRAP) and ookinete (CTRP), T. gondii (TgMIC2) (Sultan et al. Reference Sultan, Thathy, Frevert, Robson, Crisanti, Nussenzweig, Nussenzweig and Menard1997; Wan et al. Reference Wan, Carruthers, Sibley and Ajioka1997; Dessens et al. Reference Dessens, Beetsma, Dimopoulos, Wengelnik, Crisanti, Kafatos and Sinden1999; Menard, Reference Menard2000; Huynh et al. Reference Huynh, Opitz, Kwok, Tomley, Carruthers and Soldati2004), B. bovis (BbTRAP, Gaffar et al. Reference Gaffar, Yatsuda, Franssen and de Vries2004a), Eimeria (EtMIC1, Tomley et al. Reference Tomley, Billington, Bumstead, Clark and Monaghan2001), N. caninum (NcMIC2, Lovett et al. Reference Lovett, Howe and Sibley2000) and Cryptosporidium parvum (CpMIC 1, Putignani et al. Reference Putignani, Possenti, Cherchi, Pozio, Crisanti and Spano2008). All members of the TRAP family in Apicomplexa are type I transmembrane proteins which have a variable number of 2 adhesive extracellular domains: (i) integrin I domain or von Willebrand factor (vWFa) A domain and (ii) thrombospondin type I (TSR or TSP-1), followed by a transmembrane domain and a cytoplasmic tail (Starnes et al. Reference Starnes, Jewett, Carruthers and Sibley2006).
In N. caninum, 5 micronemal proteins have been described, NcMIC1, NcMIC2, NcMIC3, NcMIC4 and NcMIC10 (Sonda et al. Reference Sonda, Fuchs, Gottstein and Hemphill2000; Lovett et al. Reference Lovett, Howe and Sibley2000; Hoff et al. Reference Hoff, Cook, Sherman, Harper, Fergunson, Dubremetz and Carruthers2001; Naguleswaran et al. Reference Naguleswaran, Cannas, Keller, Vonlaufen, Björkman and Hemphill2002; Keller et al. Reference Keller, Naguleswaran, Cannas, Vonlaufen, Bienz, Bjorkman, Bohne and Hemphill2002). Preliminary analysis of ESTs from N. caninum indicated the presence of a second potential protein TRAP, besides the previously described NcMIC2 (Lovett et al. Reference Lovett, Howe and Sibley2000), which we designated as NcMIC2-like1. The presence of a second TRAP in N. caninum represents a unique fact for coccidia, including Eimeria, Toxoplasma, Sarcocystis and Cryptosporidium. Although the whole genome of T. gondii has been sequenced (Aurrecoechea et al. Reference Aurrecoechea, Brestelli, Brunk, Fischer, Gajria, Gao, Gingle, Grant, Harb, Heiges, Innamorato, Iodice, Kissinger, Kraemer, Li, Miller, Nayak, Pennington, Pinney, Roos, Ross, Srinivasamoorthy, Stoeckert, Thibodeau, Treatman and Wang2010), several investigations have unsuccessfully searched for other members of TRAP in T. gondii. Therefore, we decided to investigate NcMIC2-like1.
MATERIALS AND METHODS
Tissue culture and parasite purification
Vero cell cultures were maintained in RPMI-1640 medium (LGC Biotechnology) supplemented with 5% fetal calf serum (Cultilab), 2·05 mm glutamine, 50 U of penicillin/streptomycin at 37°C and 5% CO2 in T-25 cm2 or 75 cm2 tissue-culture flasks. Cultures were trypsinized at least once a week. N. caninum tachyzoites of the Nc-1 isolate were maintained in Vero-cell monolayers and the excess Vero cell debris was removed by exclusion chromatography in Sephadex G-25 (PD-10 columns, GE). The recovered parasites were counted in a Neubauer chamber after adequate dilution and the average recovery on 25 cm2 culture was 1×107 tachyzoites, yielding around 95% tachyzoite purification.
Determination of the full length NcMIC2-like1 cDNA sequence
The RNA ligase-mediated rapid amplification (RACE) of 5′ (primer Race 5′; CGACTGGAGCACGAGGACACTGA) and 3′ (primer Racer 3′; GCTGTCAACGATACGCTACGTAACG) cDNA ends (RLM-RACE, Gene Racer kit Invitrogen) was initially used, based on information of partial ESTs of NcMIC2-like1 available by that time (e.g. CF273823, CF261023, CF598400). The RACE PCR generated approximately 99·7% of the NcMIC2-like1 protein sequence. The non-annotated genomic database from N. caninum (www.sanger.ac.uk/cgi-bin/blast/submitblast/n_caninum) allowed the analysis of contigs flanking the NcMIC2-like1 gene region. Based on the Sanger nomenclature, the NcMIC2-like1 sequence obtained by that time was at the contig 630, which was flanked by contig 8340. Therefore, one forward primer (GGGAGATTTGAGAAGAAGCGAGA) located at the contig 8340, and a reverse primer at the contig 630 (TTTGGCGACGGGAATTACTATGG) were designed. After several PCRs and sequencing, the analyses indicated a contig between 8340 and 630, contig 1212, and it was possible to conclude that the complete NcMIC2-like1 gene sequence was located at the 1212 and 630 contigs, which were recently all merged into a single contig 1051 (http://www.sanger.ac.uk/cgi-bin/blast/getseq?id=n01DTCy929480J7997P.1;db=yeastpub/NEOS.contigs.fasta;acc=Contig1051).
Expression of recombinant NcMIC2-like1 in E. coli and generation of polyclonal antiserum
The NcMIC2-like1 open reading frame without the putative signal peptide was amplified by PCR from bases 138 (numbered from the first base of the initiation codon) to 1260 using the forward BamHI primer 5′ CCCGGATCCCAGGCAGCGTCAAATGAA 3′ and the reverse HindIII 5′ CCCAAGCTTAGATCCTGACCGACTTCT 3′ (restriction sites are bold underlined). For expression, E. coli strain BL21 was transformed with pET28/NcMIC2-like1, and cultures incubated with or without 5 mm isopropyl-β-D-thiogalactopyranoside (IPTG). Bacterial pellets were sonicated first in 10 mm Tris buffer (pH 7·0) followed by a sonication in 8 m urea, run on 10% SDS-PAGE minigels and silver stained to confirm expression. Histidine-tagged purified recombinant pET28/NcMIC2-like1 protein (150–200 μg/shot) and tachyzoite protein extract (250–300 μg/shot), quantified by the Bradford method, were used to immunize 1 rabbit each (Kawasaki et al. Reference Kawasaki, Kano, Vidotto and Vidotto2007). The animals were immunized 3 times (3-week intervals) firstly with incomplete Freund's adjuvant and subsequently with complete Freund's adjuvant, generating a polyclonal antiserum against the fragment of NcMIC2-like1 (anti-NcMIC2-like1) and against tachyzoite protein extract.
Neospora caninum tachyzoite protein extract and control
The N. caninum tachyzoite protein extract and Vero protein extract (control) were obtained by lysis of the tachyzoites (2×108 per 0·5 ml) or the Vero cells (5×106 per 0·5 ml) in 7 m urea, 2 m thiourea, and 4% CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate). The Vero control extracts (secreted and total protein) were made because we have previously observed that polyclonal antiserum cross-reacts with the cell source of the parasite (Gaffar et al. Reference Gaffar, Yatsuda, Franssen and de Vries2004a,Reference Gaffar, Yatsuda, Franssen and de Vriesb).
Secreted fraction from Neospora caninum and control
Freshly purified tachyzoites (5×107) in 1 ml of RPMI were incubated for 10 min at 37°C and subsequently in ice for 10 min, followed by mild centrifugation (3000 g, 10 min, 4°C) to remove the tachyzoites. The supernatant was then centrifuged for 10 min at higher speed (10 000 g, 4°C) to remove residual insoluble components before TCA/acetone precipitation. Equal parts of RPMI protein content were incubated with 30% trichloroacetic acid (TCA), 50 mm dithiothreitol (DTT) in acetone for 40 min at −20°C and centrifuged for 15 min, 10 000 g at 4°C. The supernatant was discarded and the pellet was then washed with 10 mm DTT in acetone and centrifuged for 5 min, 10 000 g at 4°C. The final pellet was dried at room temperature and dissolved in 7 m urea, 2 m thiourea and 4% CHAPS. The same procedure was performed with Vero cells as a control.
One dimensional (1D) electrophoresis and 1D Western blotting (WB)
The purified NcMIC2-like1 recombinant fragment, tachyzoite protein extract, secreted fraction and respective Vero controls were separated by 10% SDS-PAGE and transferred to PVDF membrane (Immobilon™-P, Millipore). The blot was blocked with 0·8% porcine gelatin (Sigma-Aldrich) diluted in phosphate-buffered saline (PBS) containing 0·5% Tween (PBST) for 1 h at 37°C. Rabbit antisera were diluted in PBST containing 0·2% porcine gelatin and incubated overnight at 4°C. The blot was washed with PBST and incubated with anti-rabbit-immunoglobulin conjugated to HRP (ZyMed-Invitrogen) for 1 h at 37°C. After washing with PBST, the blot was developed with an enhanced chemiluminescent substrate for the detection of HRP (SuperSignal West Pico Chemiluminescent Substrate, Pierce). Images of the gels and blots were acquired with LabScan v5.0 software on a flatbed scanner (Image Scanner, GE).
Two dimensional (2D) electrophoresis and 2D Western blotting
Tachyzoite protein extract (50 μg) and secreted fraction (∼25 μg) were dissolved in a rehydration solution containing 7 m urea, 2 m thiourea, 4% CHAPS, 2% carrier ampholyte mixture (pH 3–11 NL in Immobiline Drystrip gels, GE), 20 mm dithiothreitol (DTT) and supplemented with protease inhibitors (Protease Inhibitor cocktail, Sigma-Aldrich). The samples were loaded on 7 cm IPG strips (pH 3–11 NL), rehydrated and focused in an automated overnight run (IPGPhor™) using 10–14 h of rehydration, and a step voltage focusing procedure (20 min 100 V, 30 min 300 V, 1·2 h 1000 V, 15 min 5000 V, followed by 5000 V until a total of 5 Kvh was reached). Image acquisition was performed as described for one-dimensional gels/blots.
Induction assays for microneme secretion
Freshly purified tachyzoites were washed once with RPMI, pelleted (3000 g, 3 min, room temperature) and re-suspended in RPMI (2×108 ml). To induce secretion, 50 μl of tachyzoite suspension were added to 50 μl of RPMI containing doubled drug concentrations (EtOH 1%, DMSO 1%, ionomycin 400 nm or A23187 400 nm) and incubated for 2 min, 37°C. To inhibit secretion, tachyzoites were pre-treated with 100 μ m BAPTA-AM at 18°C, 10 min, then added to the drug solution and incubated for 2 min at 37°C. The supernatant was collected by sequential centrifugation (3000 g, 10 min followed by 10 000 g, 10 min), applied in a 12·5% SDS-PAGE and analysed by Western blot. The inadvertent lysis of tachyzoites was evaluated by determination of β-galactosidase activity as described by Howe et al. (Reference Howe, Mercier, Messina and Sibley1997) and Carruthers and Sibley (Reference Carruthers and Sibley1999).
Confocal immunofluorescence microscopy
For immunofluorescence, 5-day cultures of N. caninum from polylysine-coated glass coverslips were fixed in 3% paraformaldehyde in PBS. After 1 h, the coverslips were rinsed in PBS, permeabilized with PBS/0·2% Triton-X for 30 min and placed into blocking buffer solution (PBS/3% BSA/50 mm glycine) for 16 h at 4°C. Samples were rinsed in PBS and incubated with serum against recombinant NcMIC2-like1 (1:100) for 1 h, followed by 3 washes in PBS. The secondary antibody was a goat anti-rabbit–fluorescein isothiocyanate (FITC) conjugate diluted at 1:100 and nuclear staining was performed with propidium iodide (0·5 μ m). After extensive washing, the slides were embedded in glycerol and were observed on a confocal microscope (Leica TCS SP4 Laser Scanning Confocal Microscope, Leica Microsystems, Heidelberg, Germany). The images were captured by a 100× objective in oil immersion. Eight images of 0·6 μm from each channel were captured, grouped and processed by the program Image J 1.41 (National Institutes of Health, USA).
Invasion assays
Invasion of Vero cells by N. caninum tachyzoites was performed with Vero cell confluent monolayers grown in 24-well flat-bottomed tissue-culture plates (Test Plate, TPP) or 8-well (Lab-Tek Chamber Slide, Nunc) for counting, either by real-time PCR or microscopically, respectively. Freshly purified N. caninum tachyzoites (3×105 for real-time or 2×105 for microscopical assay) were resuspended in 100 μl of RPMI1640 with different sera (all diluted 1/50) and incubated for 1 h at 37°C/5%CO2. The following sera were used: pre-immune (obtained before the first immunization with recombinant NcMIC2-like1), against the recombinant NcMIC2-like1 and against tachyzoite protein extract. As controls, rabbit sera against recombinant Trypanosoma cruzi alpha dihydroorotate dehydrogenase enzyme expressed in the same vector pET28 (DHoDH) and no sera (RPMI1640 incubation) were used. These mixtures were added to cell monolayers and allowed to invade for 1 h at 37°C/5%CO2 and subsequently washed with RPMI1640. For the real-time PCR, samples were transferred to microcentrifugation tubes, and DNA was purified according to manufacturer's instructions (Wizard SV Genomic DNA Purification System, Promega). Quantification of the parasites was determined by real time PCR using the primers Nc 5, previously described (Collantes-Fernandez et al. Reference Collantes-Fernández, Zaballos, Alvarez-García and Ortega-Mora2002; Naguleswaran et al. Reference Naguleswaran, Müller and Hemphill2003; Ghalmi et al. Reference Ghalmi, China, Kaidi, Daube and Losson2008) but the forward primer was linked to FAM fluorophore Lux (Invitrogen). The experiment was carried out in a Mastercycler ep Realplex (Eppendorf) and the results analysed in the RealPlex (Eppendorf) software. As external standards, DNA corresponding to 1 to 104 parasites was used for the standard curve and the samples were calculated by interpolation from this standard curve. In the microscopical assay, monolayers were fixed with methanol for 12 h and stained with Giemsa for 10 min. For optical microscopy (Leica), 200 cells and tachyzoites detected inside these cells were counted. For both assays the final percentage of invading tachyzoites was calculated as the difference between the average value obtained by the control without serum and the value in each sample divided by the average value obtained by control without serum multiplied by 100. The invasion assays calculated by microscopic counting was performed in duplicate in 3 independent experiments and the invasion measured by real-time PCR was done in triplicate (with duplicates of them for real-time, n=6) in 3 independent assays.
Statistical analyses
The results of invasion assays were expressed as mean±standard deviation and analysis of variance (ANOVA) was employed for comparison among different experimental groups. Values among the different samples were compared by the test of Bonferroni, considering statistical significance to be less than 5%. The analyses were performed by the statistical program Graph Pad PRISM 4.0 (Graph Pad, USA).
RESULTS
Analysis of the NcMIC2-like1 amino acid sequence
Full-length NcMIC2-like1 protein was composed of 765 amino acids and the mature protein (without signal peptide) had a predicted molecular weight of 78·0 kDa and a pI of 4·55. Like its homologue NcMIC2 and TgMIC2, NcMIC2-like1 was constituted of a signal peptide, an integrin domain (I domain), 5 thrombospondin-1 (TSP-1) domains, a transmembrane region and a cytoplasmic tail. The NcMIC2-like1 deduced amino acid sequence aligned to NcMIC2 and other Apicomplexa TRAP homologues are shown in Fig. 1. NcMIC2-like1 was 39% identical (53% similar) to NcMIC2 and 38% identical (52% similar) to TgMIC2. The signal peptide had a cleavage site predicted between amino acids 33 and 34, whereas the putative transmembrane spanning helix was found between residues 687 and 756, near the C-terminus of NcMIC2-like1, which was towards residues 757–756. The adhesive domain (residues 68–247) has homology with several mammalian integrin proteins and was similar to the I domains of other Apicomplexan TRAP homologues. Five repeats, similar to the thrombospondin type 1 motif, were distributed along residues 262 up to 627 constituting the second putative adhesive domain.
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary-alt:20241023134725-73619-mediumThumb-gif-S0031182010001290_fig1g.jpg?pub-status=live)
Fig. 1. Alignment of TRAP proteins from Apicomplexan parasites. MIC2-like1 from Neospora caninum was aligned with the homologues N. caninum MIC2 (AF061273), Toxoplasma gondii MIC2 (AAB63303.1), Eimeria tenella MIC1 (AAD03350), Babesia bovis TRAP (AAS58046), Theileria parva TRAP (EAN31658), Theileria annulata TRAP (CAJ20069) and Plasmodium falciparum TRAP (AAA29777). Brackets indicate the domains, such as I Integrin, 5 Thrombospondins (TSP-s) and the transmembrane region. Arrows indicate the cleavage sites of signal peptide and rhomboids. Grey bars indicate the known regions of each domain related to interaction.
Expression of the recombinant NcMIC2-like1 protein
The expressed recombinant NcMIC2-like1 protein was auto-induced, and under silver staining, detected as a prominent 52 kDa band (Fig. 2, lane A) which was successfully purified (Fig. 2, lane B).
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary:20160921022255150-0392:S0031182010001290:S0031182010001290_fig2g.gif?pub-status=live)
Fig. 2. Recombinant NcMIC2-like1 expression, purification and detection of recombinant. (A) Plasmid pET 28/NcMIC2-like1 was expressed as an insoluble fragment of 52 KDa in E. coli BL21. (B) Ni-Sepharose purified recombinant NcMIC2-like1. (C) 1D Western blot, 1 μg of purified NcMIC2-like1 detected with anti-NcMIC2-like1 serum (1/600 000, conjugate 1/600 000). Molecular weights are indicated on the left.
Detection of native NcMIC2-like1
The 52 kDa recombinant NcMIC2-like1 was recognized by anti-NcMIC2-like1 serum (Fig. 2, lane C) and no reaction was detected on the BL21 protein extract (data not shown). The NcMIC2-like1 protein was predicted to have a molecular weight of 78 kDa and PI of 4·55 whereas the processed form (without transmembrane and cytoplasmatic tail) was predicted to be 72 kDa and PI of 4·7. The native NcMIC2-like1 forms were detected both at N. caninum tachyzoite protein extract and at the secreted fraction with 78 kDa (Fig. 3A and B, arrow 1) and at the secreted fraction with 70 kDa (Fig. 3B, arrow 2). In both cases Vero spots were recognized by the antiserum (Fig. 3, C and D), but none of them coincided with the spots mentioned previously.
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary-alt:20241023134725-80650-mediumThumb-gif-S0031182010001290_fig3g.jpg?pub-status=live)
Fig. 3. Detection of native NcMIC2-like1 by 2D Western blot with anti-NcMIC2-like1 serum on Neospora caninum (Nc) tachyzoite protein extract and secreted fraction and on respective Vero controls. (A) Anti-NcMIC2-like1 serum on tachyzoite protein extract. (B) Anti-NcMIC2-like1 serum on Nc secreted fraction. (C) Anti-NcMIC2-like1 serum on Vero protein extract. (D) Anti-NcMIC2-like1 serum on Vero secreted fraction. Arrow 1 represents putative complete form of NcMIC2-like1, arrow 2 represents putative processed form of NcMIC2-like1 and trapezoidal forms represent Vero proteins. The 2D Western blot was made on IPG 13 cm strips with pH 3-11NL and 12·5% gel. The dilution of anti-NcMIC2-like1 was 1/8000 and conjugate 1/80 000 on tachyzoite protein extract and 1/4000 (antiserum) and 1/40 000 (conjugate) on secreted fraction.
Calcium-dependent secretion of NcMIC2-like1
Similar to the pattern described for TgMIC2 (Carruthers and Sibley, Reference Carruthers and Sibley1999) and NcMIC2 (Lovett et al. Reference Lovett, Howe and Sibley2000), NcMIC2-like1 was secreted (70 kDa) when incubated with ethanol and the calcium ionophores ionomycin and A23183, whilst the process was blocked by treatment with calcium chelator BAPTA-AM (Fig. 4), indicating that secretion of NcMIC2-like1 requires intracellular Ca2+. The β-galactosidase activity (indicative of inadvertent lysis of tachyzoites) of the treated samples remained below 10% in compariston to the control with 100% of tachyzoite lysate.
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary:20160921022255150-0392:S0031182010001290:S0031182010001290_fig4g.gif?pub-status=live)
Fig. 4. Calcium-dependent secretion of NcMIC2-like1 secreted from Neospora caninum tachyzoites. Parasites were pre-treated with 100 μ m BAPTA-A (+) or not (−), and then incubated with ethanol (EtOH, 1%), DMSO (1%), ionomycin (Iono, 400 nm) or A23187 (A23, 400 nm) and the supernatants were detected by anti-NcMIC2-like1 (1/2000, conjugate 1/20 000). Beta-galactosidase activity at 570 nm was used as a control for inadvertent parasite lysis, where serial loadings of tachyzoite whole cell lysates were employed for obtaining a curve of the percentage secretion standards (% STDs). Supernatants of the treatments were compared to the standards and the values are displayed below the Western blot.
Localization of NcMIC2-like1 to micronemes
NcMIC2-like1 was apically localized when compared to the nucleus (Fig. 5) and only diffuse fluorescence was detected when the serum was used on Vero cells as a control (data not shown), suggesting specific binding.
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary:20160921022255150-0392:S0031182010001290:S0031182010001290_fig5g.jpeg?pub-status=live)
Fig. 5. Immunofluorescent localization of NcMIC2-like1 on Neospora caninum tachyzoites. Tachyzoites were labelled with rabbit anti-NcMIC2-like1 and visualized with goat anti-rabbit FITC (A). The nucleus was visualized with propidium iodide (B) and the merged image is indicated in (C). Scale bar=5 μm.
In vitro invasion assay
Tachyzoite invasion was inhibited when quantified by microscopical assay and real-time PCR (Fig. 6). Anti-NcMIC2-like1 serum inhibited the invasion process by 55·5% in the microscopical assay, while in real-time PCR inhibition was quantified to be 69·6%. Anti-tachyzoite protein extract inhibited invasion by 75·4% (microscopical assay) and 85·2% (real-time PCR). Pre-immune serum, the serum obtained before the first immunization with recombinant NcMIC2-like1, inhibited 11·5% (microscopical assay) and 20·2% (real-time). The vector control serum inhibited the invasion by 16·35% (microscopical assay) and 25·5% (real-time). All values of inhibition with anti-NcMIC2-like1 and anti-tachyzoite protein extract were significant (P<0·05), in contrast to the vector control serum (anti-alfaDHoDH, P>0·05). The results represent 3 independent experiments for the invasion assays and the real-time PCR reactions.
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary:20160921022255150-0392:S0031182010001290:S0031182010001290_fig6g.gif?pub-status=live)
Fig. 6. In vitro invasion assay of Neospora caninum tachyzoites. Tachyzoites were incubated with different sera (1/50) for 1 h before invading Vero cells. The invading tachyzoites were evaluated by microscopical assay and real time PCR. The white columns represent serum from rabbit before the first immunization procedure (pre-immune), black columns anti-DHoDH (plasmid control), dotted columns anti-NcMIC2-like1 and grid columns represents anti-Nc tachyzoite extract. *P< 0·05 in comparison to pre-immune serum.
DISCUSSION
The fact that TgMIC2 (Wan et al. Reference Wan, Carruthers, Sibley and Ajioka1997; Barragan et al. Reference Barragan, Brossier and Sibley2005) and NcMIC2 (Lovett et al. Reference Lovett, Howe and Sibley2000) are closer homologues than NcMIC2 with NcMIC2-like1 led us to designate NcMIC2-like1 as a new thrombospondin anonymous related protein. The integrin region in NcMIC2-like1 is located from amino acids 64 to 208 while in NcMIC2 from 73 to 216 and in TgMIC2 from 72 to 215. This domain is described to act in cell adhesion, migration and in signalling functions (Jonhson et al. Reference Jonhson, Lu, Denessiouk, Heino and Gullberg2009) and there is a region known as MIDAS, which is a DXSXS sequence conserved in NcMIC2-like1 as well as in TgMIC2 and NcMIC2 (Lovett et al. Reference Lovett, Howe and Sibley2000). This domain, first detected in mammals, is responsible for the coordinated binding with Mg2+ and Mn2+, mediators of recognition interactions and cell adhesion (Heckmann et al. Reference Heckmann, Laufer, Marinelli, Limongelli, Novellino, Zahn, Stragies and Kressler2009). Mutations in this domain lead to the loss of ability of interaction of integrin of T. gondii with the host cell (Brossier and Sibley, Reference Brossier and Sibley2005).
In NcMIC2-like1 there are 5 thrombospondins, similar to TgMIC2 and NcMIC2, which are responsible for the recognition of sulphate groups in proteoglycans (Soldati et al. Reference Soldati, Dubremetz and Lebrun2001). The thrombospondin domains have several conserved motifs (WSPCSVTCG, RXR and WSXWS) with similar position among homologues TgMIC2, NcMIC2 and NcMIC2-like1 (Lovett et al. Reference Lovett, Howe and Sibley2000).
In the transmembrane region, all homologues have a region of cleavage IAGG, site of rhomboid TgROM 5, essential for parasite release at the end of the invading process (Baum et al. Reference Baum, Gilberger, Frischknecht and Meissner2008). The cytoplasmic tail of NcMIC2-like1 has 32% identity and 42% similarity with NcMIC2 and 27% and 46%, respectively, with TgMIC2. Compared to the cytoplasmatic tail of TgMIC2, NcMIC2's one has 81% and 65% (Lovett et al. Reference Lovett, Howe and Sibley2000). The cytoplasmatic tails of these three proteins have various identical residues, possibly sharing a similar function in the interaction with aldolase, which is the linkage between the actin/myosin motor system and the micronemal protein (Starnes et al. Reference Starnes, Jewett, Carruthers and Sibley2006). A conserved tyrosine in TgMIC2 (also present in NcMIC2-like1) is thought to be involved in the interaction with aldolase (Brossier and Sibley, Reference Brossier and Sibley2005).
The recombinant NcMIC2-like1 was designed based on the integrin and thrombospondin domains, responsible for the attachment and gliding movement of parasite on host cell (Morahan et al. Reference Morahan, Wang and Coopel2008). The expressed recombinant protein had a higher molecular weight (52 kDa) than predicted (42 kDa) when subjected to SDS-PAGE, a fact observed for most TRAP proteins, e.g. in Plasmodium berghei, Plasmodium falciparum (Robson et al. Reference Robson, Naitza, Barker, Sinden and Crisanti1997), NcMIC2 (Lovett et al. Reference Lovett, Howe and Sibley2000) and TgMIC2 (Achbarou et al. Reference Achbarou, Mercereau-Puijalon, Autheman, Fortier, Camus and Dubremetz1991). This phenomenon is more often observed for proteins with low or high isoelectric points (TRAPs have pI 4–5) and proteins containing a large number of prolines (NcMIC2-like1 have 48) which probably lead the protein to adopt a more extended conformation as observed, for example, in collagen and casein (Robson et al. Reference Robson, Naitza, Barker, Sinden and Crisanti1997).
The native form of NcMIC2 was described with a molecular weight of 115 kDa and 95 kDa (Lovett et al. Reference Lovett, Howe and Sibley2000), much higher than the predicted weight of 78 kDa. In contrast, in our work, the native form of NcMIC2-like1 was detected to be approximately 78 kDa and its secreted form 70 kDa, which represent values close to the predicted molecular weight for the whole molecule without signal peptide (78 kDa) and after cleavage in the transmembrane region (72 kDa). A wide range of molecular weights of NcMIC2 and NcMIC2-like1 could be explained by different assumptions, such as several sites of cleavage and different forms of post-translational modifications. Microneme proteins are found in the apical complex, stored in micronemes, which have an important function for attachment and initiation of invading processes (Soldati et al. Reference Soldati, Dubremetz and Lebrun2001; Cérède et al. 2005; Ravindran and Boothroyd, 2008). Here we have demonstrated that NcMIC2-like1 is mainly located in the apical region of the tachyzoite, possibly in the micronemes, such as demonstrated for NcMIC2 (Lovett et al. Reference Lovett, Howe and Sibley2000), TgMIC2 (Brossier and Sibley, Reference Brossier and Sibley2005), TgMIC 3 (El-Hajj et al. Reference El Hajj, Papoin, Cérède, Garcia-Réguet, Soête, Dubremetz and Lebrun2008) and NcAMA 1 (Zhang et al. Reference Zhang, Compaore, Lee, Liao, Zhang, Sugimoto, Fujisaki, Nishikawa and Xuan2006). To corroborate with microneme localization, the secretion of NcMIC2-like1 was dependent on intracellular Ca2+. The discharge of microneme proteins after treatment with calcium ionophores and the blocking with calcium chelator BAPTA-AM has been described for T. gondii (Carruthers and Sibley, Reference Carruthers and Sibley1999; Kawase et al. Reference Kawase, Nishikawa, Bannai, Igarashi, Matsuo and Xuan2010) and N. caninum (Naguleswaran et al. Reference Naguleswaran, Cannas, Keller, Vonlaufen, Schares, Conraths, Bjorkman and Hemphill2001; Lovett et al. Reference Lovett, Howe and Sibley2000) and was related to regulation of the gliding movement of the parasite (Wetzel et al. Reference Wetzel, Chen, Ruiz, Moreno and Sibley2004).
The methods of measurement of invasion assays in this work consisted of microscopical assay and real-time PCR. As described by Naguleswaran et al. (Reference Naguleswaran, Müller and Hemphill2003); these different assays showed similar outcomes. In this work, both methods provided very similar results for inhibition of cell invasion; however, real-time PCR had a lower variation and percentages of inhibition were slightly, but significantly, higher than the microscopical assay method. Due to its sensitivity and specificity, the method of real-time PCR has been used for quantification of samples from Toxoplasma, Neospora and Plasmodium (Bell and Ranford-Catrwright, Reference Bell and Ranford-Cartwright2002).
The fact that antiserum against NcMIC2-like1, as a single target, inhibited invasion at high levels (up to 69%), makes this molecule a potential candidate for inclusion in a multi-component vaccine. In T. gondii, selected motifs from crucial proteins for adherence/invasion of TgMIC2, MIC3 and SAG1 have been tested as a chimera in vaccinations (Jongert et al. Reference Jongert, Verhelst, Abady, Petersen and Gargano2008). The molecular characterization initiated here on NcMIC2-like1 opens the way for more detailed studies on major essential motifs related to cell invasion and on the effectiveness of this protein under in vivo immunization assays.
ACKNOWLEDGEMENTS
The authors would like to thank Andréa Carla Quiapim (FFCLRP-USP) for the sequencing procedures and the Multi-User Laboratory of Confocal Microscopy (LMMC-FMRP-USP- Fapesp 2004/08868-0).
FINANCIAL SUPPORT
This work was supported by FAPESP (APY, research grant number 2005/53785-9 and LMP, MSc fellowship number 2006/05936-0) and CNPQ (APY Research Grant number 478767/2007-2).