Hostname: page-component-745bb68f8f-s22k5 Total loading time: 0 Render date: 2025-02-10T00:30:49.980Z Has data issue: false hasContentIssue false
  • English
  • Français

Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii

Published online by Cambridge University Press:  21 September 2009

C. SU ,
E. K. SHWAB ,
P. ZHOU ,
X. Q. ZHU  and
J. P. DUBEY
C. SU*
Affiliation:
Department of Microbiology, The University of Tennessee, Knoxville, TN 37996, USA
E. K. SHWAB
Affiliation:
Department of Microbiology, The University of Tennessee, Knoxville, TN 37996, USA
P. ZHOU
Affiliation:
Laboratory of Parasitology, College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China
X. Q. ZHU
Affiliation:
Laboratory of Parasitology, College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China
J. P. DUBEY
Affiliation:
Animal Parasitic Diseases Laboratory, United States Department of Agriculture, Beltsville, MD 20705, USA
*
*Corresponding author: Department of Microbiology, the University of Tennessee, Knoxville, TN 37966, USA. Tel: +865 974 4015. Fax: +865 974 4007. E-mail: csu1@utk.edu
Rights & Permissions [Opens in a new window]

Summary

The development of simple, sensitive and rapid methods for the detection and identification of Toxoplasma gondii is important for the diagnosis and epidemiological studies of the zoonotic disease toxoplasmosis. In the past 2 decades, molecular methods based on a variety of genetic markers have been developed, each with its advantages and limitations. The application of these methods has generated invaluable information to enhance our understanding of the epidemiology, population genetics and phylogeny of T. gondii. However, since most studies focused solely on the detection but not genetic characterization of T. gondii, the information obtained was limited. In this review, we discuss some widely used molecular methods and propose an integrated approach for the detection and identification of T. gondii, in order to generate maximum information for epidemiological, population and phylogenetic studies of this key pathogen.

Keywords

Toxoplasma gondiigenetic characterizationmolecular detection and identification
Type
Review Article
Information
Parasitology , Volume 137 , Issue 1 , January 2010 , pp. 1 - 11
Copyright
Copyright © Cambridge University Press 2009

INTRODUCTION

Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. It is the only known species in the genus Toxoplasma and is considered to be one of the most successful eukaryotic pathogens in terms of the number of host species and percentage of animals infected worldwide. Up to one-third of the human population in the world is chronically infected (Dubey and Beattie, Reference Dubey and Beattie1988; Tenter et al. Reference Tenter, Heckeroth and Weiss2000). Human infections are primarily caused by ingesting undercooked meat containing viable tissue cysts or by ingesting food or water contaminated with oocysts shed in the faeces from infected cats (Dubey, Reference Dubey2004). Primary infections in adults are mostly asymptomatic but lymphadenopathy or ocular toxoplasmosis can occur in some patients. Severe acute, disseminated toxoplasmosis can occur in immunocompetent human patients when infected with some isolates (Bossi and Bricaire, Reference Bossi and Bricaire2004). Infection acquired during pregnancy may spread and cause severe damage to the foetus. In immunocompromised patients, the reactivation of a latent infection can cause life-threatening encephalitis (Montoya and Liesenfeld, Reference Montoya and Liesenfeld2004).

T. gondii has subpopulation structures in different geographical regions. It has what appears to be a clonal population structure in North America and Europe, with 3 predominant lineages (named types I, II and III) defined by multi-locus enzyme electrophoresis (MLEE), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) or microsatellite analysis (Darde et al. Reference Darde, Bouteille and Pestre-Alexandre1992; Howe and Sibley, Reference Howe and Sibley1995; Ajzenberg et al. Reference Ajzenberg, Banuls, Tibayrenc and Darde2002a). A recent report suggests the same clonal structure in Africa (Velmurugan et al. Reference Velmurugan, Dubey and Su2008). However, T. gondii isolates from animals and human patients in South America are diverse and largely distinct from those in North America and Europe (Ajzenberg et al. Reference Ajzenberg, Banuls, Su, Dumetre, Demar, Carme and Darde2004; Khan et al. Reference Khan, Jordan, Muccioli, Vallochi, Rizzo, Belfort, Vitor, Silveira and Sibley2006; Lehmann et al. Reference Lehmann, Marcet, Graham, Dahl and Dubey2006; Pena et al. Reference Pena, Gennari, Dubey and Su2008; Dubey et al. Reference Dubey, Velmurugan, Chockalingam, Pena, De Oliveira, Leifer, Gennari, Bahia Oliveira and Su2008d). Historically, these distinct and non-type I, II or III parasites were designated as the ‘atypical’ or ‘exotic’ isolates. The low linkage disequilibrium among genetic loci of these isolates suggests that the parasites have undergone frequent sexual recombination (Ajzenberg et al. Reference Ajzenberg, Banuls, Su, Dumetre, Demar, Carme and Darde2004; Lehmann et al. Reference Lehmann, Graham, Dahl, Bahia-Oliveira, Gennari and Dubey2004; Su et al. Reference Su, Zhang and Dubey2006).

The consequences of infection with T. gondii depend on the host species and parasite genotypes. In mice, type I lineages are uniformly lethal (LD100=1); by contrast, the type II and III lineages are significantly less virulent (LD100>=103) (Sibley and Boothroyd, Reference Sibley and Boothroyd1992). In humans, disease manifestations vary widely, ranging from asymptomatic to severe acute toxoplasmosis (Bossi and Bricaire, Reference Bossi and Bricaire2004; Montoya and Liesenfeld, Reference Montoya and Liesenfeld2004). Type II is the predominant lineage causing human toxoplasmosis. However, there are biases between disease presentations and parasite genotypes. For examples, type I or type I-like atypical isolates are more likely to be involved in severe toxoplasmic retinochoroiditis in human patients (Grigg et al. Reference Grigg, Ganatra, Boothroyd and Margolis2001) and the atypical isolates often cause severe acute, disseminated toxoplasmosis in immunocompetent patients (Bossi and Bricaire, Reference Bossi and Bricaire2004).

Clinical symptoms of T. gondii infection are non-specific and unreliable for diagnosis. The conventional diagnosis of T. gondii infection usually employs serological tests, bioassays in cats and/or mice, or a combination of the 2 approaches (Dubey and Beattie, Reference Dubey and Beattie1988). In the past 2 decades, the diagnosis of T. gondii infection by direct detection of parasite-specific DNA in biological samples using PCR-based molecular methods has gained popularity. The molecular diagnosis is more sensitive and cost-effective than the conventional methods (Schoondermark-Van De Ven et al. Reference Schoondermark-Van De Ven, Melchers, Camps, Eskes, Meuwissen and Galama1994; Bessières et al. Reference Bessières, Berrebi, Cassaing, Fillaux, Cambus, Berry, Assouline, Ayoubi and Magnaval2009). There are hundreds of papers in current literature databases (such as PubMed) describing the use of these molecular methods. However, in this review article, rather than conduct an exhaustive review of all of the literature, we focus on key, representative articles to provide a perspective on establishing an integrated approach for the detection and characterization of T. gondii.

MOLECULAR METHODS FOR THE DETECTION AND IDENTIFICATION

Molecular methods rely on PCR for the specific detection or analysis of T. gondii DNA. These methods have proved to be simple, sensitive, reproducible and cost-effective, and have been applied to a variety of clinical samples from animals and humans (Bell and Ranford-Cartwright, Reference Bell and Ranford-Cartwright2002; Contini et al. Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005; Calderaro et al. Reference Calderaro, Piccolo, Gorrini, Peruzzi, Zerbini, Bommezzadri, Dettori and Chezzi2006; Bastien et al. Reference Bastien, Jumas-Bilak, Varlet-Marie and Marty2007). Molecular methods can be divided into 2 groups. The first group focuses on specific detection of T. gondii DNA in biological samples. The conventional PCR, nested PCR (n-PCR) and quantitative real-time PCR (qPCR) of repetitive DNA sequences belong to this group. The second group of molecular methods focuses on a high resolution identification of T. gondii isolates. The multilocus PCR-RFLP, microsatellite, and multilocus sequence typing (MLST) of single-copy DNA sequences belong to this group. In the following sections, we discuss the above methods in detail.

Molecular detection by conventional PCR, nested PCR (n-PCR) or quantitative real-time PCR (qPCR) of repetitive DNA sequences

To achieve high sensitivity, PCR of a small, repetitive DNA sequence is preferred, because the efficiency of amplifying a small DNA fragment is higher than that of a large one. In addition, there are more template copies in a repetitive sequence per organism. Three repetitive DNA sequences are often used for the detection of T. gondii in biological samples, including the 35-copy B1 gene, the 300-copy 529 bp repeat element and the 110-copy internal transcribed spacer (ITS-1) or 18S rDNA gene sequences. A molecular detection method (conventional PCR) for T. gondii, targeting the B1 gene, was first developed by Burg et al. (Reference Burg, Grover, Pouletty and Boothroyd1989). This method has since been modified and adapted in different laboratories (Khalifa et al. Reference Khalifa, Roth, Roth, Arasteh and Janitschke1994; Liesenfeld et al. Reference Liesenfeld, Roth, Weinke, Foss and Hahn1994; Bretagne et al. Reference Bretagne, Costa, Fleury-Feith, Poron, Dubreuil-Lemaire and Vidaud1995; Pelloux et al. Reference Pelloux, Guy, Angelici, Aspock, Bessiéres, Blatz, Del Pezzo, Girault, Gratzl, Holberg-Petersen, Johnson, Kruger, Lappalainen, Naessens and Olsson1998; Contini et al. Reference Contini, Cultrera, Seraceni, Segala, Romani, Fainardi, Cinque, Lazzarin and Delia2002, Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005; Reischl et al. Reference Reischl, Bretagne, Kruger, Ernault and Costa2003; Switaj et al. Reference Switaj, Master, Skrzypczak and Zaborowski2005; Bastien et al. Reference Bastien, Jumas-Bilak, Varlet-Marie and Marty2007). The 529 bp repeat element was identified by Homan et al. (Reference Homan, Vercammen, De Braekeleer and Verschueren2000), and it was reported to be 10- to 100-times more sensitive than the B1 gene (Homan et al. Reference Homan, Vercammen, De Braekeleer and Verschueren2000; Reischl et al. Reference Reischl, Bretagne, Kruger, Ernault and Costa2003; Calderaro et al. Reference Calderaro, Piccolo, Gorrini, Peruzzi, Zerbini, Bommezzadri, Dettori and Chezzi2006). The 110-copy ITS-1 or 18S rDNA has been used as the target in a few studies (Hurtado et al. Reference Hurtado, Aduriz, Moreno, Barandika and Garcia-Perez2001; Jauregui et al. Reference Jauregui, Higgins, Zarlenga, Dubey and Lunney2001; Calderaro et al. Reference Calderaro, Piccolo, Gorrini, Peruzzi, Zerbini, Bommezzadri, Dettori and Chezzi2006) and showed similar sensitivity to the B1 gene. To achieve higher sensitivity, n-PCR of B1 gene and ITS-1 sequences has been applied in some studies (Pelloux et al. Reference Pelloux, Guy, Angelici, Aspock, Bessiéres, Blatz, Del Pezzo, Girault, Gratzl, Holberg-Petersen, Johnson, Kruger, Lappalainen, Naessens and Olsson1998; Hurtado et al. Reference Hurtado, Aduriz, Moreno, Barandika and Garcia-Perez2001; Jauregui et al. Reference Jauregui, Higgins, Zarlenga, Dubey and Lunney2001; Contini et al. Reference Contini, Cultrera, Seraceni, Segala, Romani, Fainardi, Cinque, Lazzarin and Delia2002, Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005; Bastien et al. Reference Bastien, Jumas-Bilak, Varlet-Marie and Marty2007), both markers showed high sensitivity, with the detection level being as low as 1 parasite (Hurtado et al. Reference Hurtado, Aduriz, Moreno, Barandika and Garcia-Perez2001; Jauregui et al. Reference Jauregui, Higgins, Zarlenga, Dubey and Lunney2001; Calderaro et al. Reference Calderaro, Piccolo, Gorrini, Peruzzi, Zerbini, Bommezzadri, Dettori and Chezzi2006). For a given repetitive sequence, n-PCR is more sensitive than conventional PCR. A case in point is that the n-PCR of the B1 gene is more sensitive than the conventional PCR for the detection of T. gondii in amniotic fluid samples from congenital toxoplasmosis of human (Okay et al. Reference Okay, Yamamoto, Oliveira, Manuli, Andrade Junior and Del Negro2009). Recently, we employed a set of primers for n-PCR of T. gondii 18S rDNA, and found that it was more sensitive than the B1 gene (data not shown). The 18S rDNA marker is of particular interest, as it can distinguish several protozoan parasites which are closely related to T. gondii. There is further discussion of this marker in a later section (toward an integrated approach for molecular detection and identification) of this article.

In recent years, qPCR that targets the repetitive DNA sequences, has shown high sensitivity (detecting ~1 parasite genome equivalent) (Jauregui et al. Reference Jauregui, Higgins, Zarlenga, Dubey and Lunney2001; Reischl et al. Reference Reischl, Bretagne, Kruger, Ernault and Costa2003; Contini et al. Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005; Calderaro et al. Reference Calderaro, Piccolo, Gorrini, Peruzzi, Zerbini, Bommezzadri, Dettori and Chezzi2006; Edvinsson et al. Reference Edvinsson, Lappalainen and Evengard2006). The qPCR approach has gained popularity for not only detecting but also quantifying T. gondii in biological samples (Bell and Ranford-Cartwright, Reference Bell and Ranford-Cartwright2002; Contini et al. Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005). Its sensitivity is superior to n-PCR assays (Contini et al. Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005) and can detect T. gondii over a range of 6–7 orders of magnitude (Lin et al. Reference Lin, Chen, Kuo, Tseng and Tseng2000; Jauregui et al. Reference Jauregui, Higgins, Zarlenga, Dubey and Lunney2001; Contini et al. Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005). Quantification of T. gondii by qPCR has been applied to the detection of the parasite in animal tissues and whole blood or amniotic fluids of human clinical samples (Lin et al. Reference Lin, Chen, Kuo, Tseng and Tseng2000; Jauregui et al. Reference Jauregui, Higgins, Zarlenga, Dubey and Lunney2001; Kupferschmidt et al. Reference Kupferschmidt, Kruger, Held, Ellerbrok, Siegert and Janitschke2001; Contini et al. Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005). Since it can estimate the intensity of T. gondii infection in the patients following drug treatment, qPCR is extremely useful to monitor the progression of infections under treatment and to diagnose low-level infections or carrier states (Contini et al. Reference Contini, Seraceni, Cultrera, Incorvaia, Sebastiani and Picot2005). The 529 bp element is a preferred target for qPCR, as it provides a sensitivity of 6 repeat equivalents, or 1/50 of a genome equivalent (Kasper et al. Reference Kasper, Sadeghi, Prusa, Reischer, Kratochwill, Förster-Waldl, Gerstl, Hayde, Pollak and Herkner2009), currently representing the most sensitive assay for the detection of T. gondii.

Rapid and accurate detection of T. gondii infection is pivotal for prompt treatment of clinical toxoplasmosis. However, the above-mentioned detection methods (conventional PCR, n-PCR and qPCR of repetitive DNA sequences) provide no information beyond a positive diagnosis. To better understand the epidemiology of the parasite, there is an increasing interest and need in the genetic classification of T. gondii. In the following section, we discuss the methods used for the genetic identification and characterization of this parasite.

Molecular characterization by multilocus PCR-RFLP, microsatellite or multilocus sequence typing (MLST) analysis

For epidemiological studies, it is important to identify individual T. gondii isolates and to track the source of contamination. The commonly used methods for these purposes are multilocus PCR-RFLP, microsatellite or MLST typing. The PCR-RFLP is based on the ability of restriction endonucleases to recognize single nucleotide polymorphisms (SNPs), digest PCR products and subsequently display distinct DNA banding patterns on agarose gels by electrophoresis (Sibley and Boothroyd, Reference Sibley and Boothroyd1992; Howe and Sibley, Reference Howe and Sibley1995). Microsatellite analysis is based on the DNA sequence length polymorphisms of short nucleotide tandem repeats. The tandem repeats in T. gondii are often simple, consisting of as few as 2 nucleotides (di-nucleotide repeats), and occur 2–20 times (Blackston et al. Reference Blackston, Dubey, Dotson, Su, Thulliez, Sibley and Lehmann2001; Ajzenberg et al. Reference Ajzenberg, Banuls, Tibayrenc and Darde2002a, Reference Ajzenberg, Banuls, Su, Dumetre, Demar, Carme and Darde2004). The MLST is based on DNA sequence polymorphisms including the SNPs, insertion and deletion of nucleotides in the sequence. SNPs and microsatellites are predicted to mutate at different evolutionary rates. For eukaryotes in general, the mutation rate for SNPs is estimated at 10−9–10−10 per nucleotide position per replication, whereas the rate for microsatellites is 10−2–10−5 per locus per replication (Goldstein and Schlotterer, Reference Goldstein and Schlotterer1999). Although the exact mutation rates of SNPs and microsatellites are not known in T. gondii, it is clear that the latter have a higher mutation rate and can provide enhanced resolution in typing (Ajzenberg et al. Reference Ajzenberg, Banuls, Tibayrenc and Darde2002a). The microsatellites are useful in distinguishing genetically closely related T. gondii isolates. Since multilocus PCR-RFLP and microsatellite typing are simple and cost effective compared with MLST typing, they are preferred tools for characterization of T. gondii in epidemiological studies.

A hallmark study of the epidemiology and population structure of T. gondii was conducted more than a decade ago on 106 isolates collected from humans and animals in North America and Europe (Howe and Sibley, Reference Howe and Sibley1995). In this study, 6 PCR-RFLP markers were used and 3 predominant lineages (types I, II and III) were identified. It was concluded that T. gondii had a clonal population structure (Howe and Sibley, Reference Howe and Sibley1995). Since then, different sets of multilocus PCR-RFLP or microsatellite markers have been applied to epidemiological and population studies (Blackston et al. Reference Blackston, Dubey, Dotson, Su, Thulliez, Sibley and Lehmann2001; Ajzenberg et al. Reference Ajzenberg, Banuls, Tibayrenc and Darde2002a, Reference Ajzenberg, Cogne, Paris, Bessieres, Thulliez, Filisetti, Pelloux, Marty and Dardeb, Reference Ajzenberg, Banuls, Su, Dumetre, Demar, Carme and Darde2004, Reference Ajzenberg, Dumetre and Darde2005; Lehmann et al. Reference Lehmann, Graham, Dahl, Bahia-Oliveira, Gennari and Dubey2004, Reference Lehmann, Marcet, Graham, Dahl and Dubey2006; Khan et al. Reference Khan, Su, German, Storch, Clifford and Sibley2005a, Reference Khan, Taylor, Su, Mackey, Boyle, Cole, Glover, Tang, Paulsen, Berriman, Boothroyd, Pfefferkorn, Dubey, Ajioka, Roos, Wootton and Sibleyb; Ferreira et al. Reference Ferreira, Vitor, Gazzinelli and Melo2006, Reference Ferreira, Vidal, Costa-Silva, Meira, Hiramoto, Penalva De Oliveira and Pereira-Chioccola2008; Su et al. Reference Su, Zhang and Dubey2006). A key finding of these studies was that T. gondii isolates from South America were highly diverse and distinct from those of North America and Europe. It was concluded that, in South America, T. gondii has an epidemic population structure (Ajzenberg et al. Reference Ajzenberg, Banuls, Su, Dumetre, Demar, Carme and Darde2004; Lehmann et al. Reference Lehmann, Graham, Dahl, Bahia-Oliveira, Gennari and Dubey2004, Reference Lehmann, Marcet, Graham, Dahl and Dubey2006; Pena et al. Reference Pena, Gennari, Dubey and Su2008). However, the comparing of genotypes among different studies has been difficult or impossible, as different markers have been employed in different laboratories.

The disadvantage of using a single-copy gene or genomic sequence is that the sensitivity is compromised compared with a highly repetitive sequence. A technical challenge to multilocus typing is that often samples are limited both in volume and in DNA amount, particularly from tissues from clinical cases or the mouse bioassay. To alleviate this problem, we have developed a multiplex multilocus nested PCR-RFLP (Mn-PCR-RFLP) method employing 10 genetic markers, including SAG1, SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1 and Apico (Dubey et al. Reference Dubey, Sundar, Gennari, Minervino, Farias, Ruas, Dos Santos, Cavalcante, Kwok and Su2007e). The sensitivity of this method is estimated at 10 or more T. gondii genome equivalents, based on a previous study with 4 (SAG2, SAG3, BTUB and GRA6) of these 10 markers (Khan et al. Reference Khan, Su, German, Storch, Clifford and Sibley2005a). In contrast, the sensitivity of conventional PCR-RFLP is estimated at ⩾100 T. gondii genome equivalents (unpublished data). In Mn-PCR-RFLP typing, all markers are pre-amplified by multiplex PCR using external primers in a single reaction, and the pre-amplified PCR products are used as templates to amplify each individual marker by n-PCR (Fig. 1). The advantage of this approach is that only a limited amount of individual sample is needed, which is particularly useful when only small amounts of ‘precious’ samples are available. Mn-PCR-RFLP analysis has been applied to the genetic typing of a large number of animal isolates bioassayed in mice, generating a substantial amount of data regarding genetic diversity and population structure of the parasite (Dubey et al. Reference Dubey, Cortés-Vecino, Vargas-Duarte, Sundar, Velmurugan, Bandini, Polo, Zambrano, Mora, Kwok, Smith and Su2007a-g, 2008 a-e; Pena et al. Reference Pena, Gennari, Dubey and Su2008; Sundar et al. Reference Sundar, Cole, Thomas, Majumdar, Dubey and Su2008; Velmurugan et al. Reference Velmurugan, Dubey and Su2008; Dubey and Su, Reference Dubey and Su2009). This method has also been used for the genetic characterization of T. gondii DNA extracted from the brains of sea otters (Sundar et al. Reference Sundar, Cole, Thomas, Majumdar, Dubey and Su2008) and arctic foxes (Prestrud et al. Reference Prestrud, Åsbakk, Mørk, Fuglei, Tryland and Su2008). Application of this method to a broad range of samples will greatly facilitate our understanding of molecular epidemiology and population diversity of T. gondii in the near future. When the amount of DNA for T. gondii isolates is not limited, the MLST typing is the method of choice because it has the highest resolution among all typing methods. Recent studies of T. gondii using this approach have revealed alleles unique to parasite isolates in Brazil (Khan et al. Reference Khan, Jordan, Muccioli, Vallochi, Rizzo, Belfort, Vitor, Silveira and Sibley2006, Reference Khan, Fux, Su, Dubey, Darde, Ajioka, Rosenthal and Sibley2007), emphasizing the importance of a sequencing approach for studying the population genetics and molecular phylogeny of T. gondii.

Fig. 1. Multiplex multilocus nested PCR-RFLP (Mn-PCR-RFLP) typing. Several genetic loci are pre-amplified by multiplex PCR with external primers. Then each individual locus is amplified by nested PCR using internal primers. The nested PCR products are treated with restriction enzymes and resolved in agarose gel to reveal strain-specific DNA banding patterns (RFLP typing). Horizontal lines represent DNA sequences and the horizontal arrows represent PCR primers.

TOWARD AN INTEGRATED APPROACH FOR MOLECULAR DETECTION AND IDENTIFICATION

Each of the detection and identification methods discussed above has its advantages and/or limitations, depending on application. A comparison of these methods is presented in Table 1. At present, most clinical studies have focused on detecting the presence of T. gondii DNA in biological samples using the highly sensitive nested or qPCR of repetitive DNA sequences, but little has been done to further characterize the parasites. This is because each of these markers (B1 gene, 529 bp repetitive element, or ITS-1) has identical or near-identical repetitive sequences, therefore they are not adequate for genetic typing. The conventional multilocus PCR-RFLP analysis method relies on single-copy polymorphic DNA sequences, and usually a relatively large amount of starting templates from the parasite is required. Therefore, it has been difficult to genetically identify T. gondii in clinical samples, due to the extremely small amounts of parasite DNA available. The recent development of the Mn-PCR-RFLP method makes it possible to genetically characterize or classify T. gondii from clinical samples with high resolution.

Table 1. Comparison of the methods for molecular detection and characterization of Toxoplasma gondii

Here, we propose an integrated approach for the detection and genetic characterization of T. gondii. This approach should include detection of T. gondii infection in biological samples by n-PCR or qPCR of repetitive DNA sequences (employing the B1 gene or the 529-bp repeat element), followed by Mn-PCR-RFLP for the subsequent identification of T. gondii. There are a number of protocols developed in several laboratories for the detection of T. gondii by qPCR or n-PCR (Costa et al. Reference Costa, Pautas, Ernault, Foulet, Cordonnier and Bretagne2000; Reischl et al. Reference Reischl, Bretagne, Kruger, Ernault and Costa2003; Edvinsson et al. Reference Edvinsson, Lappalainen and Evengard2006; Calderaro et al. Reference Calderaro, Piccolo, Gorrini, Peruzzi, Zerbini, Bommezzadri, Dettori and Chezzi2006; Kasper et al. Reference Kasper, Sadeghi, Prusa, Reischer, Kratochwill, Förster-Waldl, Gerstl, Hayde, Pollak and Herkner2009). Although the sensitivity of these protocols varies among different laboratories, all studies demonstrate that the 529 bp repeat element is the most sensitive target, with a detection limit of ⩾1/50 of a genome equivalent (Kasper et al. Reference Kasper, Sadeghi, Prusa, Reischer, Kratochwill, Förster-Waldl, Gerstl, Hayde, Pollak and Herkner2009). Regardless of the protocol employed, all test-positive samples should be further characterized genetically by the Mn-PCR-RFLP typing method. The PCR primer sequences and experimental conditions for this typing method are listed in Table 2. This integrated approach will provide maximum information for epidemiological studies in order to address questions regarding the association of disease manifestations with parasite genotypes and virulence.

Table 2. Summary of primers for multiplex multilocus nested PCR-RFLP (Mn-PCR-RFLP) typing (Su and Dubey, Reference Su, Dubey and Liu2009)

(The multiplex PCR reaction is carried out in a vol. of 25 μl containing 1× PCR buffer, 2 mM MgCl2, 200 μM each of the dNTPs, 0·15 μM each of the external forward and reverse primers, 1 unit of FastStart DNA polymerase (Roche, Indianapolis, IN) and 1·5 μl of DNA samples. The reaction mixture is treated at 95°C for 4 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 1 min and 72°C for 2 min. Multiplex PCR amplified products are diluted (1:1) by adding 25 μl of nuclease-free water. The nested PCR reaction is carried out in a vol. of 25 μl containing 1× PCR buffer, 2 mM MgCl2, 200 μM each of the dNTPs, 0·30 μM each of internal forward and reverse primers, 1 unit FastStart DNA polymerase and 1·5 μl of diluted multiplex PCR products. The reaction mixture is treated at 95°C for 4 min, followed by 35 cycles of 94°C for 30 sec, 60°C for 1 min and 72°C for 1·5 min (for marker Apico, the annealing temperature is at 58°C instead of 60°C). For RFLP typing, 3–5 μl of nested PCR products are treated with restriction enzymes in a vol. of 20 μl and the digested samples are resolved in agarose gel to reveal DNA banding patterns (Su et al. Reference Su, Zhang and Dubey2006).)

* F, forward primer; R, reverse primer.

For phylogenetic studies, MLST is preferred for its high resolution. Conventional PCR based MLST requires the samples to have a relatively high concentration of genomic DNA (⩾100 genome equivalents per PCR). Taking the Mn-PCR approach, we have been able to generate quality DNA sequence data from samples containing as low as 10 genome equivalent (data not published). The major precaution for this approach is that, if errors occur in the early cycles of PCR, erroneous sequences may be generated. This problem can be solved by sequencing at least 2 independent PCR products from the same sample. To standardize studies and facilitate comparison among different laboratories, it is strongly recommended that all sequencing efforts include a few commonly used introns such as UPRT-1, UPRT-7, EF1 and HP (Khan et al. Reference Khan, Jordan, Muccioli, Vallochi, Rizzo, Belfort, Vitor, Silveira and Sibley2006, Reference Khan, Fux, Su, Dubey, Darde, Ajioka, Rosenthal and Sibley2007) and the GRA6 gene (Fazaeli et al. Reference Fazaeli, Carter, Darde and Pennington2000).

For genomic DNA samples extracted directly from animal tissues, we suggest screening all samples using n-PCR targeting the 18S rDNA sequence prior to Mn-PCR-RFLP typing for T. gondii. By sequence analysis of the 18S rDNA for a number of closely related apicomplexan parasites, we identified SNPs that can distinguish T. gondii, Hammondia hammondi, Neospora caninum and Sarcocystis neurona by RFLP analysis (Fig. 2). For n-PCR of 18S rDNA, the external primers are: Tg18s48F, CCATGCATGTCTAAGTATAAGC and Tg18s359R, GTTACCCGTCACTGCCAC, which amplify a 312bp DNA fragment from T. gondii. The nested PCR primers are: Tg18s58F, CTAAGTATAAGCTTTTATACGGC and Tg18s348R, TGCCACGGTAGTCCAATAC, which amplify a 291bp DNA fragment from T. gondii. These primers were designed based on sequences conserved for the above 4 parasites. The GenBank Accession numbers of these sequences are M97703 (T. gondii), AF096498 (H. hammondi), U17346 (N. caninum) and U07812 (S. neurona). Using this marker, we recently detected a mixed infection of Sarcocystis tenella and T. gondii from sheep brain tissues (data not published). The 18S rDNA marker provides an excellent tool for detecting apicomplexans that are closely related to T. gondii in animal samples, which will add additional value to the studies on T. gondii infection in animal populations.

Fig. 2. PCR-RFLP gel image for Toxoplasma gondii, Hammondia hammondi, Neospora caninum and Sarcocystis neurona based on the 18S rDNA marker. PCR products from each parasite species were digested with 3 restriction enzymes DdeI, MspI, Hpy188III (New England Biolabs Inc.) in a single reaction and DNA fragments were separated in 3% agarose gels. Samples GT1, PTG and CTG represent T. gondii. All 4 apicomplexan species have unique banding patterns and can be clearly distinguished (mouse and human DNA were used as negative controls and no PCR products were amplified, not shown). MK: Low molecular weight DNA ladder (New England Biolabs Inc.).

To monitor contamination of PCR amplification in Mn-PCR-RFLP genotyping, negative controls without DNA template should be included in each batch of experiments. In addition, a set of reference T. gondii isolates should be included to monitor the efficiency of PCR amplification and restriction enzyme digestion. This is very important, because for each batch of experiments there can be variation in efficiency of restriction digestion and sometimes incomplete digestion, and the concentration of electrophoretic gel can also vary slightly among experiments. Including T. gondii reference isolates in every experiment and on every electrophoretic gel will ensure the accuracy of results. The suggested references include RH88, GT1, PTG, CTG, TgCgCa1 (a.k.a. Cougar, COUG), MAS, TgCatBr5, TgCatBr64 and TgRsCr1 (Su et al. Reference Su, Zhang and Dubey2006; Dubey et al. Reference Dubey, Velmurugan, Morales, Arguedas and Su2009). The genetic data for these reference strains are summarized in Table 3. A set of gel images is presented in Fig. 3.

Fig. 3. Multiplex multilocus nested PCR-RFLP (Mn-PCR-RFLP) analysis of Toxoplasma gondii samples using 10 different genetic markers. T. gondii reference strains are GT1 (or RH88), PTG, CTG, TgCgCa1 (a.k.a. Cougar, COUG), MAS, TgCatBr5, TgCatBr64 and TgRsCr1. Nested PCR products from each marker were digested with selected restriction enzymes (Table 2), and DNA fragments were separated in agarose. All markers were resolved in 2·5% gels, except that Apico was resolved in 3% gels. MK, low molecular weight DNA ladder (New England Biolabs Inc.).

Table 3. Summary of multilocus PCR-RFLP typing for Toxoplasma gondii reference isolates

* At SAG1 locus, type II and III are indistinguishable.

† SAG2 marker based on 5′- and 3′-ends of the gene sequence (Howe et al. Reference Howe, Honore, Derouin and Sibley1997).

‡ A SAG2 marker based on the 5′-end of the gene sequence but different from 5′-SAG2 (Su et al. Reference Su, Zhang and Dubey2006).

u-1 and u-2 are new alleles that are different from the clonal type I, II and III alleles.

Currently, there is a lack of standard nomenclature for T. gondii genetic typing. Historically, genetic markers were selected based on polymorphisms in DNA or protein sequences among the clonal type I, II, and III lineages, and the corresponding alleles were designated either as I, II, III, or 1, 2, 3, respectively (Darde et al. Reference Darde, Bouteille and Pestre-Alexandre1992; Sibley and Boothroyd, Reference Sibley and Boothroyd1992; Ajzenberg et al. Reference Ajzenberg, Banuls, Su, Dumetre, Demar, Carme and Darde2004; Ferreira et al. Reference Ferreira, Vitor, Gazzinelli and Melo2006; Khan et al. Reference Khan, Jordan, Muccioli, Vallochi, Rizzo, Belfort, Vitor, Silveira and Sibley2006; Su et al. Reference Su, Zhang and Dubey2006; Pena et al. Reference Pena, Gennari, Dubey and Su2008). Alleles which are distinct from those of types I, II or III were designated as either unique-1 (u-1), unique-2 (u-2), unique-3 (u-3) etc., or 4, 5, 6, etc. In Table 3 and Fig. 3, we use the former scheme to describe new alleles.

In summary, the application of an integrated approach, combining molecular detection and high resolution genetic characterization, should assist in enhancing our understanding of the molecular epidemiology, population genetics and phylogeny of T. gondii, which will be beneficial to the control of T. gondii transmission and a reduction of toxoplasmosis in humans and animals.

ACKNOWLEDGEMENTS

This work was supported in part by the Department of Microbiology, University of Tennessee Knoxville (CS, Startup grant); the Chinese National Special Research Program for Non-Profit Trades (XQZ, Grant No. 200803017); and the Program for Changjiang Scholars and Innovative Research Team in University – China (XQZ, Grant No. IRT0723).

References

REFERENCES

Ajzenberg, D., Banuls, A. L., Su, C., Dumetre, A., Demar, M., Carme, B. and Darde, M. L. (2004). Genetic diversity, clonality and sexuality in Toxoplasma gondii. International Journal for Parasitology 34, 1185–1196.CrossRefGoogle ScholarPubMed
Ajzenberg, D., Banuls, A. L., Tibayrenc, M. and Darde, M. L. (2002 a). Microsatellite analysis of Toxoplasma gondii shows considerable polymorphism structured into two main clonal groups. International Journal for Parasitology 32, 27–38.CrossRefGoogle ScholarPubMed
Ajzenberg, D., Cogne, N., Paris, L., Bessieres, M. H., Thulliez, P., Filisetti, D., Pelloux, H., Marty, P. and Darde, M. L. (2002 b). Genotype of 86 Toxoplasma gondii isolates associated with human congenital toxoplasmosis, and correlation with clinical findings. Journal of Infectious Diseases 186, 684–689.CrossRefGoogle ScholarPubMed
Ajzenberg, D., Dumetre, A. and Darde, M.-L. (2005). Multiplex PCR for typing strains of Toxoplasma gondii. Journal of Clinical Microbiology 43, 1940–1943.CrossRefGoogle ScholarPubMed
Bastien, P., Jumas-Bilak, E., Varlet-Marie, E. and Marty, P. (2007). Three years of multi-laboratory external quality control for the molecular detection of Toxoplasma gondii in amniotic fluid in France. Clinical Microbiology and Infection 13, 430–433.CrossRefGoogle ScholarPubMed
Bell, A. and Ranford-Cartwright, L. (2002). Real-time quantitative PCR in parasitology. Trends in Parasitology 18, 337–342.CrossRefGoogle ScholarPubMed
Bessières, M. H., Berrebi, A., Cassaing, S., Fillaux, J., Cambus, J. P., Berry, A., Assouline, C., Ayoubi, J. M. and Magnaval, J. F. (2009). Diagnosis of congenital toxoplasmosis: prenatal and neonatal evaluation of methods used in Toulouse University Hospital and incidence of congenital toxoplasmosis. Memorias do Instituto Oswaldo Cruz 104, 389–392.CrossRefGoogle ScholarPubMed
Blackston, C. R., Dubey, J. P., Dotson, E., Su, C., Thulliez, P., Sibley, D. and Lehmann, T. (2001). High-resolution typing of Toxoplasma gondii using microsatellite loci. Journal of Parasitology 87, 1472–1475.CrossRefGoogle ScholarPubMed
Bossi, P. and Bricaire, F. (2004). Severe acute disseminated toxoplasmosis. The Lancet 364, 579.CrossRefGoogle ScholarPubMed
Bretagne, S., Costa, J. M., Fleury-Feith, J., Poron, F., Dubreuil-Lemaire, M. L. and Vidaud, M. (1995). Quantitative competitive PCR with bronchoalveolar lavage fluid for diagnosis of toxoplasmosis in AIDS patients. Journal of Clinical Microbiology 33, 1662–1664.CrossRefGoogle ScholarPubMed
Burg, J. L., Grover, C. M., Pouletty, P. and Boothroyd, J. C. (1989). Direct and sensitive detection of a pathogenic protozoan Toxoplasma gondii, by polymerase chain reaction. Journal of Clinical Microbiology 27, 1787–1792.CrossRefGoogle ScholarPubMed
Calderaro, A., Piccolo, G., Gorrini, C., Peruzzi, S., Zerbini, L., Bommezzadri, S., Dettori, G. and Chezzi, C. (2006). Comparison between two real-time PCR assays and a nested-PCR for the detection of Toxoplasma gondii. Acta Bio Medica 77, 75–80.Google Scholar
Contini, C., Cultrera, R., Seraceni, S., Segala, D., Romani, R., Fainardi, E., Cinque, P., Lazzarin, A. and Delia, S. (2002). The role of stage-specific oligonucleotide primers in providing effective laboratory support for the molecular diagnosis of reactivated Toxoplasma gondii encephalitis in patients with AIDS. Journal of Medical Microbiology 51, 879–890.CrossRefGoogle ScholarPubMed
Contini, C., Seraceni, S., Cultrera, R., Incorvaia, C., Sebastiani, A. and Picot, S. (2005). Evaluation of a Real-time PCR-based assay using the lightcycler system for detection of Toxoplasma gondii bradyzoite genes in blood specimens from patients with toxoplasmic retinochoroiditis. International Journal for Parasitology 35, 275–283.CrossRefGoogle ScholarPubMed
Costa, J. M., Pautas, C., Ernault, P., Foulet, F., Cordonnier, C. and Bretagne, S. (2000). Real-time PCR for diagnosis and follow-up of Toxoplasma reactivation after allogeneic stem cell transplantation using fluorescence resonance energy transfer hybridization probes. Journal of Clinical Microbiology 38, 2929–2932.CrossRefGoogle ScholarPubMed
Darde, M. L., Bouteille, B. and Pestre-Alexandre, M. (1992). Isoenzyme analysis of 35 Toxoplasma gondii isolates and the biological and epidemiological implications. Journal of Parasitology 78, 786–794.CrossRefGoogle ScholarPubMed
Dubey, J. P. (2004). Toxoplasmosis – a waterborne zoonosis. Veterinary Parasitology 126, 57–72.CrossRefGoogle ScholarPubMed
Dubey, J. P., Applewhaite, L., Sundar, N., Velmurugan, G. V., Bandini, L. A., Kwok, O. C., Hill, R. and Su, C. (2007 g). Molecular and biological characterization of Toxoplasma gondii isolates from free-range chickens from Guyana, South America, identified several unique and common parasite genotypes. Parasitology 134, 1559–1565.CrossRefGoogle ScholarPubMed
Dubey, J. P. and Beattie, C. P. (1988). Toxoplasmosis of Animals and Man. CRC Press, Boca Raton, FL, USA.Google Scholar
Dubey, J. P., Cortés-Vecino, J. A., Vargas-Duarte, J. J., Sundar, N., Velmurugan, G. V., Bandini, L. M., Polo, L. J., Zambrano, L., Mora, L. E., Kwok, O. C. H., Smith, T. and Su, C. (2007 a). Prevalence of Toxoplasma gondii in dogs from Colombia, South America and genetic characterization of T. gondii isolates. Veterinary Parasitology 145, 45–50.CrossRefGoogle ScholarPubMed
Dubey, J. P., Hill, D. E., Sundar, N., Velmurugan, G. V., Bandini, L. A., Kwok, O. C., Pierce, V., Kelly, K., Dulin, M., Thulliez, P., Iwueke, C. and Su, C. (2008 a). Endemic toxoplasmosis in pigs on a farm in Maryland: isolation and genetic characterization of Toxoplasma gondii. Journal of Parasitology 94, 36–41.CrossRefGoogle ScholarPubMed
Dubey, J. P., Huong, L. T. T., Sundar, N. and Su, C. (2007 b). Genetic characterization of Toxoplasma gondii isolates in dogs from Vietnam suggests their South American origin. Veterinary Parasitology 146, 347–351.CrossRefGoogle ScholarPubMed
Dubey, J. P., Lopez-Torres, H. Y., Sundar, N., Velmurugan, G. V., Ajzenberg, D., Kwok, O. C. H., Hill, R., Darde, M. L. and Su, C. (2007 c). Mouse-virulent Toxoplasma gondii isolated from feral cats on Mona Island, Puerto Rico. Journal of Parasitology 93, 1365–1369.CrossRefGoogle ScholarPubMed
Dubey, J. P., Quirk, T., Pittt, J. A., Sundar, N., Velmurugan, G. V., Kwok, O. C., Hill, R. and Su, C. (2008 b). Isolation and genetic characterization of Toxoplasma gondii from raccoons (Procyon lotor), cats (Felis domesticus), striped skunk (Mephitis mephitis), black bear (Ursus americanus), and cougar (Puma concolor) from Canada. Journal of Parasitology 94, 42–45.CrossRefGoogle ScholarPubMed
Dubey, J. P., Rajapakse, R. P. V. J., Wijesundera, R. R. M. K. K., Sundar, N., Velmurugan, G. V., Kwok, O. C. H. and Su, C. (2007 d). Prevalence of Toxoplasma gondii in dogs from Sri Lanka and genetic characterization of the parasite isolates. Veterinary Parasitology 146, 341–346.CrossRefGoogle ScholarPubMed
Dubey, J. P. and Su, C. (2009). Population biology of Toxoplasma gondii: what's out and where did they come from. Memorias do Instituto Oswaldo Cruz 104, 190–195.CrossRefGoogle ScholarPubMed
Dubey, J. P., Sundar, N., Gennari, S. M., Minervino, A. H. H., Farias, N. A. D. R., Ruas, J. L., Dos Santos, T. R. B., Cavalcante, G. T., Kwok, O. C. H. and Su, C. (2007 e). Biologic and genetic comparison of Toxoplasma gondii isolates in free-range chickens from the northern Para state and the southern state Rio Grande do Sul, Brazil revealed highly diverse and distinct parasite populations. Veterinary Parasitology 143, 182–188.CrossRefGoogle Scholar
Dubey, J. P., Sundar, N., Hill, D., Velmurugan, G. V., Bandini, L. A., Kwok, O. C. H., Majumdar, D. and Su, C. (2008 c). High prevalence and abundant atypical genotypes of Toxoplasma gondii isolated from lambs destined for human consumption in the USA. International Journal for Parasitology 38, 999–1006.CrossRefGoogle ScholarPubMed
Dubey, J. P., Sundar, N., Nolden, C. A., Samuel, M. D., Velmurugan, G. V., Bandini, L. A., Kwok, O. C. H., Bodenstein, B. and Su, C. (2007 f). Characterization of Toxoplasma gondii from raccoons (Procyon lotor), coyotes (Canis latrans), and striped skunks (Mephitis mephitis) in Wisconsin identified several atypical genotypes. Journal of Parasitology 93, 1524–1527.CrossRefGoogle ScholarPubMed
Dubey, J. P., Velmurugan, G. V., Chockalingam, A., Pena, H. F. J., De Oliveira, L. N., Leifer, C. A., Gennari, S. M., Bahia Oliveira, L. M. G. and Su, C. (2008 d). Genetic diversity of Toxoplasma gondii isolates from chickens from Brazil. Veterinary Parasitology 157, 299–305.CrossRefGoogle ScholarPubMed
Dubey, J. P., Velmurugan, G., Morales, J. A., Arguedas, R. and Su, C. (2009). Isolation of Toxoplasma gondii from the keel-billed toucan (Ramphastos sulfuratus) from Costa Rica. Journal of Parasitology 95, 467–468.CrossRefGoogle ScholarPubMed
Dubey, J. P., Velmurugan, G. V., Ulrich, V., Gill, J., Carstensen, M., Sundar, N., Kwok, O. C. H., Thulliez, P., Majumdar, D. and Su, C. (2008 e). Transplacental toxoplasmosis in naturally-infected white-tailed deer: Isolation and genetic characterisation of Toxoplasma gondii from foetuses of different gestational ages. International Journal for Parasitology 38, 1057–1063.CrossRefGoogle ScholarPubMed
Edvinsson, B., Lappalainen, M. and Evengard, B. (2006). Real-time PCR targeting a 529-bp repeat element for diagnosis of toxoplasmosis. Clinical Microbiology and Infection 12, 131–136.CrossRefGoogle ScholarPubMed
Fazaeli, A., Carter, P. E., Darde, M. L. and Pennington, T. H. (2000). Molecular typing of Toxoplasma gondii strains by GRA6 gene sequence analysis. International Journal for Parasitology 30, 637–642.CrossRefGoogle ScholarPubMed
Ferreira, A. D. M., Vitor, R. W., Gazzinelli, R. T. and Melo, M. N. (2006). Genetic analysis of natural recombinant Brazilian Toxoplasma gondii strains by multilocus PCR-RFLP. Infection, Genetics and Evolution 6, 22–31.CrossRefGoogle ScholarPubMed
Ferreira, I. M., Vidal, J. E., Costa-Silva, T. A., Meira, C. S., Hiramoto, R. M., Penalva De Oliveira, A. C. and Pereira-Chioccola, V. L. (2008). Toxoplasma gondii: genotyping of strains from Brazilian AIDS patients with cerebral toxoplasmosis by multilocus PCR-RFLP markers. Experimental Parasitology 118, 221–227.CrossRefGoogle ScholarPubMed
Goldstein, D. B. and Schlotterer, C. (1999). Microsatellites: Evolution and Applications, Oxford University Press, Oxford, UK.CrossRefGoogle Scholar
Grigg, M. E., Ganatra, J., Boothroyd, J. C. and Margolis, T. P. (2001). Unusual abundance of atypical strains associated with human ocular toxoplasmosis. Journal of Infectious Diseases 184, 633–639.CrossRefGoogle ScholarPubMed
Homan, W. L., Vercammen, M., De Braekeleer, J. and Verschueren, H. (2000). Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. International Journal for Parasitology 30, 69–75.CrossRefGoogle ScholarPubMed
Howe, D. K., Honore, S., Derouin, F. and Sibley, L. D. (1997). Determination of genotypes of Toxoplasma gondii strains isolated from patients with toxoplasmosis. Journal of Clinical Microbiology 35, 1411–1414.CrossRefGoogle ScholarPubMed
Howe, D. K. and Sibley, L. D. (1995). Toxoplasma gondii comprises three clonal lineages: correlation of parasite genotype with human disease. Journal of Infectious Diseases 172, 1561–1566.CrossRefGoogle ScholarPubMed
Hurtado, A., Aduriz, G., Moreno, B., Barandika, J. and Garcia-Perez, A. L. (2001). Single tube nested PCR for the detection of Toxoplasma gondii in fetal tissues from naturally aborted ewes. Veterinary Parasitology 102, 17–27.CrossRefGoogle ScholarPubMed
Jauregui, L. H., Higgins, J., Zarlenga, D., Dubey, J. P. and Lunney, J. K. (2001). Development of a real-time PCR assay for detection of Toxoplasma gondii in pig and mouse tissues. Journal of Clinical Microbiology 39, 2065–2071.CrossRefGoogle ScholarPubMed
Kasper, D. C., Sadeghi, K., Prusa, A.-R., Reischer, G. H., Kratochwill, K., Förster-Waldl, E., Gerstl, N., Hayde, M., Pollak, A. and Herkner, K. R. (2009). Quantitative real-time polymerase chain reaction for the accurate detection of Toxoplasma gondii in amniotic fluid. Diagnostic Microbiology and Infectious Disease 63, 10–15.CrossRefGoogle ScholarPubMed
Khalifa, K. E. S., Roth, A., Roth, B., Arasteh, K. N. and Janitschke, K. (1994). Value of PCR for evaluating occurrence of parasitemia in immunocompromised patients with cerebral and extracerebral toxoplasmosis. Journal of Clinical Microbiology 32, 2813–2819.CrossRefGoogle Scholar
Khan, A., Fux, B., Su, C., Dubey, J. P., Darde, M. L., Ajioka, J. W., Rosenthal, B. M. and Sibley, L. D. (2007). Recent transcontinental sweep of Toxoplasma gondii driven by a single monomorphic chromosome. Proceedings of the National Academy of Sciences, USA 104, 14872–14877.CrossRefGoogle ScholarPubMed
Khan, A., Jordan, C., Muccioli, C., Vallochi, A. L., Rizzo, L. V., Belfort, R. Jr., Vitor, R. W. A., Silveira, C. and Sibley, L. D. (2006). Genetic divergence of Toxoplasma gondii strains associated with ocular Toxoplasmosis, Brazil. Emerging and Infectious Diseases 12, 942–949.CrossRefGoogle ScholarPubMed
Khan, A., Su, C., German, M., Storch, G. A., Clifford, D. B. and Sibley, L. D. (2005 a). Genotyping of Toxoplasma gondii Strains from immunocompromised patients reveals high prevalence of type I strains. Journal of Clinical Microbiology 43, 5881–5887.CrossRefGoogle ScholarPubMed
Khan, A., Taylor, S., Su, C., Mackey, A. J., Boyle, J., Cole, R., Glover, D., Tang, K., Paulsen, I. T., Berriman, M., Boothroyd, J. C., Pfefferkorn, E. R., Dubey, J. P., Ajioka, J. W., Roos, D. S., Wootton, J. C. and Sibley, L. D. (2005 b). Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acids Research 33, 2980–2992.CrossRefGoogle ScholarPubMed
Kupferschmidt, O., Kruger, D., Held, T. K., Ellerbrok, H., Siegert, W. and Janitschke, K. (2001). Quantitative detection of Toxoplasma gondii DNA in human body fluids by TaqMan polymerase chain reaction. Clinical Microbiology and Infection 7, 120–124.CrossRefGoogle ScholarPubMed
Lehmann, T., Graham, D. H., Dahl, E. R., Bahia-Oliveira, L. M., Gennari, S. M. and Dubey, J. P. (2004). Variation in the structure of Toxoplasma gondii and the roles of selfing, drift, and epistatic selection in maintaining linkage disequilibria. Infection, Genetics and Evolution 4, 107–114.CrossRefGoogle ScholarPubMed
Lehmann, T., Marcet, P. L., Graham, D. H., Dahl, E. R. and Dubey, J. P. (2006). Globalization and the population structure of Toxoplasma gondii. Proceedings of the National Academy of Sciences, USA 103, 11423–11428.CrossRefGoogle ScholarPubMed
Liesenfeld, O., Roth, A., Weinke, T., Foss, H. D. and Hahn, H. (1994). A case of disseminated toxoplasmosis-value of PCR for the diagnosis. Journal of Infection 29, 133–138.CrossRefGoogle ScholarPubMed
Lin, M. H., Chen, T. C., Kuo, T., Tseng, C. C. and Tseng, C. P. (2000). Real-time PCR for quantitative detection of Toxoplasma gondii. Journal of Clinical Microbiology 38, 4121–4125.CrossRefGoogle ScholarPubMed
Montoya, J. G. and Liesenfeld, O. (2004). Toxoplasmosis. The Lancet 363, 1965–1976.CrossRefGoogle ScholarPubMed
Okay, T. S., Yamamoto, L., Oliveira, L. C., Manuli, E. R., Andrade Junior, H. F. D. and Del Negro, G. M. B. (2009). Significant performance variation among PCR systems in diagnosing congenital toxoplasmosis in São Paulo, Brazil: analysis of 467 amniotic fluid samples. Clinics 64, 171–176.CrossRefGoogle Scholar
Pelloux, H., Guy, D., Angelici, M. C., Aspock, H., Bessiéres, M., Blatz, R., Del Pezzo, M., Girault, V., Gratzl, R., Holberg-Petersen, M., Johnson, J., Kruger, D., Lappalainen, M., Naessens, A. and Olsson, M. (1998). A second European collaborative study on polymerase chain reaction for Toxoplasma gondii, involving 15 teams. FEMS Microbiology Letters 165, 231–237.CrossRefGoogle Scholar
Pena, H. F. J., Gennari, S. M., Dubey, J. P. and Su, C. (2008). Population structure and mouse-virulence of Toxoplasma gondii in Brazil. International Journal for Parasitology 38, 561–569.CrossRefGoogle ScholarPubMed
Prestrud, K. W., Åsbakk, K., Mørk, T., Fuglei, E., Tryland, M. and Su, C. (2008). Direct high-resolution genotyping of Toxoplasma gondii in arctic foxes (Vulpes lagopus) in the remote arctic Svalbard archipelago reveals widespread clonal type II lineage. Veterinary Parasitology 158, 121–128.CrossRefGoogle ScholarPubMed
Reischl, U., Bretagne, S., Kruger, D., Ernault, P. and Costa, J. M. (2003). Comparison of two DNA targets for the diagnosis of Toxoplasmosis by real-time PCR using fluorescence resonance energy transfer hybridization probes. BMC Infectious Diseases 3, 7.CrossRefGoogle ScholarPubMed
Schoondermark-Van De Ven, E., Melchers, W., Camps, W., Eskes, T., Meuwissen, J. and Galama, J. (1994). Effectiveness of spiramycin for treatment of congenital Toxoplasma gondii infection in Rhesus monkeys. Antimicrobial Agents and Chemotherapy 38, 1930–1936.CrossRefGoogle ScholarPubMed
Sibley, L. D. and Boothroyd, J. C. (1992). Virulent strains of Toxoplasma gondii comprise a single clonal lineage. Nature, London 359, 82–85.CrossRefGoogle ScholarPubMed
Su, C. and Dubey, J. P. (2009). Toxoplasma. In Molecular Detection of Foodborne Pathogens (ed. Liu, D.), pp. 741–753. CRC Press, Boca Raton, FL, USA.Google Scholar
Su, C., Zhang, X. and Dubey, J. P. (2006). Genotyping of Toxoplasma gondii by multilocus PCR-RFLP markers: A high resolution and simple method for identification of parasites. International Journal for Parasitology 36, 841–848.CrossRefGoogle ScholarPubMed
Sundar, N., Cole, R. A., Thomas, N. J., Majumdar, D., Dubey, J. P. and Su, C. (2008). Genetic diversity among sea otter isolates of Toxoplasma gondii. Veterinary Parasitology 151, 125–132.CrossRefGoogle ScholarPubMed
Switaj, K., Master, A., Skrzypczak, M. and Zaborowski, P. (2005). Recent trends in molecular diagnostics for Toxoplasma gondii infections. Clinical Microbiology and Infection 11, 170–176.CrossRefGoogle ScholarPubMed
Tenter, A. M., Heckeroth, A. R. and Weiss, L. M. (2000). Toxoplasma gondii: from animals to humans. International Journal for Parasitology 30, 1217–1258.CrossRefGoogle ScholarPubMed
Velmurugan, G. V., Dubey, J. P. and Su, C. (2008). Genotyping studies of Toxoplasma gondii isolates from Africa revealed that the archetypal clonal lineages predominate as in North America and Europe. Veterinary Parasitology 155, 314–318.CrossRefGoogle Scholar
Figure 0

Fig. 1. Multiplex multilocus nested PCR-RFLP (Mn-PCR-RFLP) typing. Several genetic loci are pre-amplified by multiplex PCR with external primers. Then each individual locus is amplified by nested PCR using internal primers. The nested PCR products are treated with restriction enzymes and resolved in agarose gel to reveal strain-specific DNA banding patterns (RFLP typing). Horizontal lines represent DNA sequences and the horizontal arrows represent PCR primers.

Figure 1

Table 1. Comparison of the methods for molecular detection and characterization of Toxoplasma gondii

Figure 2

Table 2. Summary of primers for multiplex multilocus nested PCR-RFLP (Mn-PCR-RFLP) typing (Su and Dubey, 2009)(The multiplex PCR reaction is carried out in a vol. of 25 μl containing 1× PCR buffer, 2 mM MgCl2, 200 μM each of the dNTPs, 0·15 μM each of the external forward and reverse primers, 1 unit of FastStart DNA polymerase (Roche, Indianapolis, IN) and 1·5 μl of DNA samples. The reaction mixture is treated at 95°C for 4 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 1 min and 72°C for 2 min. Multiplex PCR amplified products are diluted (1:1) by adding 25 μl of nuclease-free water. The nested PCR reaction is carried out in a vol. of 25 μl containing 1× PCR buffer, 2 mM MgCl2, 200 μM each of the dNTPs, 0·30 μM each of internal forward and reverse primers, 1 unit FastStart DNA polymerase and 1·5 μl of diluted multiplex PCR products. The reaction mixture is treated at 95°C for 4 min, followed by 35 cycles of 94°C for 30 sec, 60°C for 1 min and 72°C for 1·5 min (for marker Apico, the annealing temperature is at 58°C instead of 60°C). For RFLP typing, 3–5 μl of nested PCR products are treated with restriction enzymes in a vol. of 20 μl and the digested samples are resolved in agarose gel to reveal DNA banding patterns (Su et al.2006).)

Figure 3

Fig. 2. PCR-RFLP gel image for Toxoplasma gondii, Hammondia hammondi, Neospora caninum and Sarcocystis neurona based on the 18S rDNA marker. PCR products from each parasite species were digested with 3 restriction enzymes DdeI, MspI, Hpy188III (New England Biolabs Inc.) in a single reaction and DNA fragments were separated in 3% agarose gels. Samples GT1, PTG and CTG represent T. gondii. All 4 apicomplexan species have unique banding patterns and can be clearly distinguished (mouse and human DNA were used as negative controls and no PCR products were amplified, not shown). MK: Low molecular weight DNA ladder (New England Biolabs Inc.).

Figure 4

Fig. 3. Multiplex multilocus nested PCR-RFLP (Mn-PCR-RFLP) analysis of Toxoplasma gondii samples using 10 different genetic markers. T. gondii reference strains are GT1 (or RH88), PTG, CTG, TgCgCa1 (a.k.a. Cougar, COUG), MAS, TgCatBr5, TgCatBr64 and TgRsCr1. Nested PCR products from each marker were digested with selected restriction enzymes (Table 2), and DNA fragments were separated in agarose. All markers were resolved in 2·5% gels, except that Apico was resolved in 3% gels. MK, low molecular weight DNA ladder (New England Biolabs Inc.).

Figure 5

Table 3. Summary of multilocus PCR-RFLP typing for Toxoplasma gondii reference isolates