INTRODUCTION
Leishmaniasis is clinically and epidemiologically a diverse disease caused by obligatory, intracellular, haemoflagellate protozoan parasites of the genus Leishmania (family Trypanosomatidae). The disease, prevalent in 88 countries, manifests in a variety of clinical forms, ranging from the self-healing cutaneous disease to the more serious, potentially fatal visceralizing form. Visceral leishmaniasis (VL) or KA is of higher priority than cutaneous leishmaniasis (CL) as it is a fatal disease in the absence of treatment. There are 350 million people at risk with 500 000 new cases of VL and 1–1·5 million for CL per year and with DALYs: 2·4 millions (Desjeux, Reference Desjeux2004). Anthroponotic foci of VL such as India and Sudan are of special concern as they are at the origin of frequent and deadly epidemics (Desjeux, Reference Desjeux2004). Post-kala-azar dermal leishmaniasis (PKDL) is a dermatotropic form of leishmaniasis developed in cured KA patients (El Hassan et al. Reference El-Hassan, Ghalib, Zijlstra, Eltoum, Satti, Ali and Ali1992; Ramesh and Mukherjee, Reference Ramesh and Mukherjee1995). The onset of PKDL is variable: PKDL may appear during or directly after treatment or up to 2 years post-treatment in Sudan, while in India the period between KA and PKDL is generally long ranging from 6 months to 20 years with an average of 3 years (Zijlstra et al. Reference Zijlstra, Musa, Khalil, El-Hassan and El-Hassan2003). PKDL patients are considered to be an important source in VL transmission in the absence of an animal reservoir in India and are considered to contribute to the increasing antimony resistance in India (Addy and Nandy, Reference Addy and Nandy1992; Singh et al. Reference Singh, Kumar, Ramesh, Singh and Salotra2006). The disease is characterized by the development of hypo-pigmented macules, papules and nodules, which first appear around the mouth; those which do not heal spontaneously become denser and spread over the entire body. A minimal mixed chronic inflammatory infiltrate consisting of plasma cells, lymphocytes and histiocytes in the perivascular areas of the upper dermis has been described in macules of PKDL (Ramesh, Reference Ramesh1993; Ramesh and Mukherjee, Reference Ramesh and Mukherjee1995).
The causative organism isolated from PKDL patients has been shown to be L. d. donovani, though intrinsic differences in the PKDL and KA isolates have been demonstrated. Differences have been observed amongst PKDL and KA isolates at LdP13 and β-tubulin locus (Sreenivas et al. Reference Sreenivas, Subba Raju, Singh, Selvapandiyan, Duncan, Sarkar, Nakhasi and Salotra2004a; Dey and Singh, Reference Dey and Singh2006). Comparative gene expression profiling of PKDL and KA isolates revealed the upregulation of cell surface proteins in PKDL parasites (Salotra et al. Reference Salotra, Duncan, Singh, Subba Raju, Sreenivas and Nakhasi2006). For detection of genetic polymorphism among species and strains of Leishmania different methods have been used including PCR and PCR SSCP to scan single base differences (Noyes et al. Reference Noyes, Belli and Maingon1996; Schonian et al. Reference Schönian, Schweynoch, Zlateva, Oskam, Kroon, Gräser and Presber1996). Genetic fingerprinting has been carried out for Leishmania parasites isolated from all forms of leishmaniasis reported from various geographical regions including India. Such analyses have been carried out on Indian KA isolates but as yet no studies are reported for the fingerprinting of Leishmania parasites isolated from PKDL patients.
Arbitrary primed PCR (AP-PCR) with random oligos is capable of producing unique genetic fingerprints from closely related organisms and this property has been utilized to differentiate several groups of parasites from trypanosomatids (Tibayrenc et al. Reference Tibayrenc, Neubauer, Barnabe, Guerrine, Skarecky and Ayala1993; Waitumbi and Murphy, Reference Waitumbi and Murphy1993), coccidial (Procunier et al. Reference Procunier, Fernando and Barta1993), to schistosome parasites (Neto et al. Reference Neto, deSouza, Rollinson, Katz, Pena and Simpson1993). AP-PCR has been used to produce unique DNA fingerprints differentiating several Leishmania species or isolates (Pogue et al. Reference Pogue, Koul, Lee, Dwyer and Nakhasi1995a). Due to the low complexity of the Leishmania genome the application of AP-PCR has been extended from DNA fingerprinting to surveying the genome for gene sequences of interest (Pogue et al. Reference Pogue, Koul, Lee, Dwyer and Nakhasi1995a, Reference Pogue, Lee, Koul, Dwyer and Nakhasib; Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b). The ability of AP-primers to amplify DNA from diverse portions of an organism's genome allows screening of genomic DNA from a wide range of gene sequences with little bias, and has led to identification of several differentially expressed RNAs (Pogue et al. Reference Pogue, Lee, Koul, Dwyer and Nakhasi1995b).
Leishmania exists in 2 life-stages i.e. the promastigote present in the vector sandfly and the amastigote stage present in the vertebrate host. Identification of differentially expressed genes is important as those overexpressed in the amastigote stage are considered to be the virulence molecules which underlie the pathogenesis of the disease; thereby providing the necessary target for disruption of the disease cycle. A number of studies have been carried out to ascertain changes in gene expression amongst Leishmania stages, using methods such as differential or subtractive hybridization, differential display and cDNA microarrays derived from spliced leader libraries and genomic microarray (Heard et al. Reference Heard, Lewis and Chaudhuri1996; Liu et al. Reference Liu, Zinker, Arguello and Salgado2000; Wu et al. Reference Wu, El Fakhry, Sereno, Tamar and Papadopoulou2000; Almeida et al. Reference Almeida, Norrish, Levick, Vetrie, Freeman, Vilo, Ivens, Lange, Stober, McCann and Blackwell2002; Bellatin et al. Reference Bellatin, Murray, Zhao and McMaster2002; McNicoll et al. Reference McNicoll, Drummelsmith, Muller, Madore, Boilard, Ouellette and Papadopoulou2006). AP-PCR has been used to identify polymorphic fragments which lead to identification of genes that are expressed differentially in the promastigote and amastigote stages of Leishmania (Pogue et al. Reference Pogue, Koul, Lee, Dwyer and Nakhasi1995a, Reference Pogue, Lee, Koul, Dwyer and Nakhasib; Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b). Here, we have exploited the AP-PCR technique to map genetic differences within the PKDL isolates of L. donovani and to identify DNA polymorphisms that distinguish geographical isolates. Further, we utilized the polymorphic DNA fragments to identify, isolate and characterize genes differentially expressed in promastigote and amastigote stages of the parasite.
MATERIALS AND METHODS
Patients and parasite culture
Parasite isolates were collected from dermal lesions of PKDL patients as described previously (Salotra et al. Reference Salotra, Sreenivas, Pogue, Lee, Nakhasi, Ramesh and Negi2001; Singh et al. Reference Singh, Kumar, Ramesh, Singh and Salotra2006). The patients presented with hypo-pigmented macules, papules and nodules. PKDL was confirmed by demonstration of amastigotes in skin biopsies. Informed consent was obtained from patients before collecting the biopsy material, according to the guidelines of the Ethical Committee, Safdarjung Hospital, New Delhi. Clinical isolates of L. donovani included in the study were prepared from 14 patients of PKDL (P1–P14) and 3 kala azar patients (LdK1–LdK3) that reported to Safdarjung Hospital between years 2001 and 2004. The reference stocks of Leishmania used in this study were L. donovani 1S from Sudan (WHO designation, MHOM/SD/00/1S-Cl2D), L. donovani WR 684 from Ethiopia (MHOM/ET/67/82), L. donovani AG83 from India (MHOM/IN/83/AG83) and L. d. infantum from Spain (MACAN/SP/100/XXX).
Cultures of promastigotes and axenic amastigotes
Promastigotes were cultured at 24°C in M199 medium with 25 mm HEPES (pH 7·4) supplemented with 10% heat-inactivated fetal calf serum, 100 IU and 100 μg/ml each of penicillin G and streptomycin, respectively. Promastigotes were propagated in the same medium at 24°C for 4–5 passages, before harvesting for DNA extraction or transformation into amastigotes. Cytodifferentiation into axenic amastigotes was accomplished by inducing promastigotes to gradually adapt to altered growth conditions, as described earlier (Joshi et al. Reference Joshi, Dwyer and Nakhasi1993; Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b).
Isolation of nucleic acids
Genomic DNA and total RNA were prepared from minimally passaged parasites from kala-azar and PKDL isolates. Mid-log phase parasites (1–2×109) were washed twice with cold PBS and used for DNA isolation by Wizard Genomic DNA kit (Promega). Total RNA from promastigotes and axenic amastigotes was prepared from parasites at identical time-points using Trizol reagent (Invitrogen). Bone marrow aspirates (BMA) and skin tissue samples from KA and PKDL patients were collected prior to treatment in Trizol, and stored in liquid nitrogen before isolation of total RNA.
AP-PCR reactions
AP-PCR reactions were carried out under essentially similar conditions as described earlier (Pogue et al.Reference Pogue, Koul, Lee, Dwyer and Nakhasi1995a, Reference Pogue, Lee, Koul, Dwyer and Nakhasib; Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b). The following AP primers were used: AP8-TGCCGAGCTG; AP9-GTTGCGATCC; AP-10-AGGTGACCGT; AP16-CAGCACCCAC. Briefly, the reaction was performed in a 50 μl reaction mixture containing 200 μm each of dNTP, 2 mm MgCl2, 100 ng of oligonucleotide, 100 ng of template DNA (unless stated otherwise) and 2·5 units of Taq DNA polymerase overlaid with mineral oil. The reaction was amplified with the following cycling conditions: denaturation at 94°C for 1 min, annealing at 36°C for 1 min and extension at 72°C for 2 min for a total of 45 cycles followed by a final extension of 15 min at 72°C. Amplification products from AP-PCR reactions were analysed by electrophoresis in 1% agarose gels and staining with ethidium bromide. The pattern of AP-PCR amplification fragments has been shown to be sensitive to the amount of genomic DNA template and the amount of AP oligo (Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b). The amounts of template and oligos were optimized for obtaining reproducible amplification from all Leishmania species tested. In the case of oligo AP-9, AP-10 amplification reactions were also carried out with 50 ng, 100 ng and 150 ng of template DNA to obtain additional unique DNA fragments.
Cloning of polymorphic fragments
Polymorphic DNA bands were sliced from the agarose gels and purified with QiaQuick gel extraction kit (Qiagen) following the manufacturer's protocol. The polymorphic bands were ligated in to pGEM-T Easy Vector-TA (Promega) according to the manufacturer's instructions.
Northern hybridization
To validate whether the polymorphic bands were inferring from the transcribed region, selected clones were subjected to Northern blot analysis. Total RNA (10 μg/lane) from PKDL and KA promastigotes/amastigotes was separated in formaldehyde gels, transferred to nylon membranes and hybridized with 32P labelled probe prepared from random labelling reaction using NEB blot kit (New England Biolabs). The stained rRNA signal intensities were used to normalize for RNA loading using AlphaEase Chemi-imager V5.5. The quantitated hybridization intensity was used to calculate the relative expression of various genes in promastigotes/amastigotes of PKDL and KA.
Nucleotide sequence analysis
The cloned polymorphic fragments identified from AP-PCR were sequenced using automated sequencing machine single capillary node (ABI-310). Sequences were subjected to BLAST analysis to check for homology with known sequences in the database. The sequence generated was sufficient to find the homologous regions of the L. major and L. infantum genomes by BLAST searches of the databases (www.genedb.org). Sequences were submitted to GenBank and assigned Accession numbers.
Expression analysis of FeSOD
Total RNA (5 μg) from promastigote or axenic amastigotes was used to synthesize first strand cDNA in a reaction containing oligo dT20 primer, 2 μl of 0·1 m DTT, 1 μl of 10 mm dNTP mix, 10 U RNAsin and 200 units of superscript II reverse transcriptase following the manufacturer's instruction (Invitrogen). Amplification reactions were conducted with primers for the constitutively expressed housekeeping gene α-tubulin for normalization of amounts of RNA. The amplification of FeSOD b1 and b2 UTRs was carried out under the following conditions: initial denaturation of 5 min at 94°C followed by 94°C for 45 sec, annealing 56°C for 1 min and extension at 72°C for 2 min for 36 cycles followed by final extension of 5 min. α-Tubulin was amplified under the following conditions, initial denaturation for 2 min followed by 35 cycles of 94°C for 30 sec, 55°C for 30 sec 72°C for 45 sec followed by final extension of 5 min at 72°C. Primers were designed using Primer 3 software (http://wwwgenome.wi.mit.edu/genome_software/other/primer3.html). Primer sequences used in various experiments were as follows:
- fesodb1 3′ UTR
Forward-5′ GATGCGCAGTTTGGAGTTCAC 3′
Reverse-5′ GACAACGGTAGGGTCGCCAGAGAG 3′
- fesodb2 3′ UTR
Forward-5′ CTGGTGGCTCCCACTACGTCAAC 3′
Reverse-5′ CTCCTGCCTCTGCTTCCGTG 3′
- α-tubulin
Forward-5′ TTTTTTTTCGCCCTCGTCG 3′
Reverse-5′ GCCCCCCTCCACAGATACAC 3′
Control experiments were performed with amplification using total RNA in the absence of reverse transcriptase to check for DNA contamination. RT-PCR was carried out in RNAs from 3 different parasite isolates in promastigote and amastigote stages.
Demonstration of transcripts of DEAD box RNA helicase in Leishmania-infected tissue lesion
Total RNA (5 μg) from parasite infected tissue lesion of PKDL and KA patients was reverse transcribed into cDNA. The DEAD box RNA helicase ORF was amplified following the PCR conditions as described in the previous section except the annealing temperature was 63°C for 1 min using the following primer sequence.
- DEAD box RNA helicase
Forward-5′ ATGGCAGAGCGTAACTACAGCCCCT 3′
Reverse-5′ CTATTGGCGCGCGCGCTTG 3′
- Hu HPRT
Forward-5′ CGAGATGTGATGAAGGAGATGGG 3′
Reverse-5′ CCTGACCAAGGAAAGCAAAGTCTG 3′
Human housekeeping gene HPRT was amplified for the normalization of lesion tissue RNA.
RESULTS
Parasite isolation and characterization
Initially, all Leishmania isolates derived from PKDL lesions were characterized as Leishmania donovani by immunofluorescence (IFA) using genus (G2D10) and species specific (D2, T2 and T10) monoclonal antibodies against L. donovani, L. major and L. tropica, obtained as a kind gift from TDR, WHO (Jaffe et al. Reference Jaffe, Bennettm, Grimaldi and McMahon-Pratt1984; Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b). In addition, all parasite isolates were characterized as L. donovani by isoenzyme analysis using a panel of enzymes (6PGD, G6PDH, NH, ME and MDH).
Fingerprinting of PKDL isolates by AP-PCR
AP-PCR has been shown to be an attractive tool in assigning specific fingerprint to L. donovani geographical isolates that are morphologically and biochemically indistinguishable (Pogue et al. Reference Pogue, Koul, Lee, Dwyer and Nakhasi1995a, Reference Pogue, Lee, Koul, Dwyer and Nakhasib). In the current study the PKDL isolates (n=14) were subjected to genomic fingerprinting by AP-PCR analysis using primers AP-8, AP-9, AP-10 and AP-16. All PKDL isolates depicted almost identical fingerprinting patterns using primers AP-10 and AP-16 and the pattern was comparable with the predominant isotype of Indian KA isolate LdK1 (Fig. 1A and B). The AP-PCR analysis with primer AP-8 and AP-9 also gave an identical fingerprinting pattern with all PKDL isolates (data not shown). L. donovani isolates from different geographical regions i.e. L. donovani 1S from Sudan, L. donovani WR 684 from Ethiopia (MHOM/IN/83/AG83) and L. d. infantum from Spain (MACAN/SP/100/XXX) were also compared and revealed a distinct pattern in comparison with PKDL isolates as well as standard L. donovani AG83 from India (data not shown).
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary-alt:20160629080629-31129-mediumThumb-S0031182007003484_fig1g.jpg?pub-status=live)
Fig. 1. Fingerprinting of Indian PKDL isolates of Leishmania donovani by AP-PCR using oligo AP-10 and AP-16. Genomic DNA (100 ng) from parasite cultures from PKDL lesions (P1–P14) and kala-azar isolate (LdK1) was amplified and separated on agarose gel. M-DNA marker, 1 kb ladder. (A) Genomic fingerprint using AP-10; (B) fingerprinting pattern using AP-16 oligo.
Identification of polymorphic fragments in PKDL L. donovani
The pattern of AP-PCR is known to be highly dependent on the amount of genomic DNA template and primer (Pogue et al. Reference Pogue, Koul, Lee, Dwyer and Nakhasi1995a, Reference Pogue, Lee, Koul, Dwyer and Nakhasib; Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b). With altered template DNA concentration, different patterns were obtained with AP-9 and AP-10 with PKDL isolates in comparison with L. donovani isolates of KA. Attempts to identify fragments unique to PKDL isolates resulted in polymorphic bands in comparison with KA isolates with AP-9, AP-10 and AP-8 using different amounts of genomic DNA (50 ng, 100 ng, and 150 ng). The polymorphic bands were obtained reproducibly with all PKDL isolates and the representative data with P1 and LdK1 are shown (Fig. 2).
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary-alt:20160629080955-91399-mediumThumb-S0031182007003484_fig2g.jpg?pub-status=live)
Fig. 2. AP-PCR analysis for identification of polymorphic fragment using oligo AP-9, AP-10 and AP-8. PCR was carried out using varying concentrations of DNA from parasites P1 and LdK1. (A) 50 ng template DNA amplified with oligo AP-9; (B) 100 ng template DNA with AP-9; (C) 150 ng template DNA amplified with oligo AP-9; (D) 50 ng template DNA with oligo AP-10; (E) 150 ng template DNA with oligo AP-10; (F) 100 ng template DNA with AP-8 primer.
The polymorphic bands of sizes approximately 520 bp, 300 bp and 450 bp obtained from AP PCR with AP-9 were designated as P-520, P-300 and P-450 based on the size of fragment (Fig. 2 A, B and C). AP-PCR analysis with oligo AP-10 using 100 ng genomic DNA did not reveal any polymorphic band in comparison to KA isolates (Fig. 1A); however, altered DNA concentration resulted in polymorphic bands. A distinct polymorphic band at 700 bp (designated P-700) was obtained with P1 when the DNA amount was 50 ng, while the corresponding band in KA isolates was very faint (Fig. 2D). Similarly, when tested with 150 ng DNA concentration with the same oligo AP-10, a distinct polymorphic band of 1·1 kb (designated P1100) was pictured with P1 isolate which was barely evident in KA isolate LdK1 (Fig. 2E). AP-PCR analysis with AP-8 primer using 100 ng template illustrated a polymorphic fragment at about 1·3 kb in comparison to KA isolate (Fig. 2F).
Northern blot analysis using polymorphic fragments
The polymorphic fragments were used in Northern analysis to determine if they represented transcribed sequences and if they corresponded to differentially expressed genes. P-520 hybridized to a 2·8 kb mRNA species that was found to be overexpressed (1·5±0·2-fold; mean±s.d.) in promastigotes of both PKDL and KA isolates (Fig 3A). Another fragment P-300 that hybridized to 2·5 kb mRNA was also upregulated (1·7±0·1-fold) in the promastigote stage of the parasite (Fig. 3B). The third fragment P-450 hybridized to 2·3kb RNA that had 1·8±0·1-fold higher expression in the amastigote stage compared to the promastigote stage (Fig. 3C).
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary-alt:20160629081253-36256-mediumThumb-S0031182007003484_fig3g.jpg?pub-status=live)
Fig. 3. Northern hybridization with total RNA isolated from promastigotes (Pro) or amastigotes (Am) of P1 and LdK1, using as probes the polymorphic fragments identified in AP-PCR. (A) P-520; (B) P-300; (C) P-450; (D) P700; (E) P-1100. Ethidium bromide stained rRNA was used for normalization. Validation was carried out in RNAs from 3 different parasite isolates of each type and representative data are shown.
Polymorphic fragments incurred from AP-10 were cloned and tested in Northern blot analysis. The probe P-700, when tested in Northern blot, hybridized to an ~2·9 kb size mRNA and revealed an equal mRNA transcriptional level in both stages of parasites (Fig. 3D). Northern analysis showed that the P1.1 hybridized to 2 species of mRNA of size 3·6 and 3·4 kb. The expression was differential in 2 stages of both PKDL and KA isolates, being 2·5±0·35-fold higher in the amastigote stage in comparison with promastigotes (Fig. 3E). Northern blot analysis with the polymorphic fragment 1·3 kb obtained from AP-8 did not yield any signal when blotted, indicating that the fragment obtained from our analysis probably belonged to a non-transcriptional region (data not shown). The current study demonstrated that a majority of AP-PCR fragments incurred from PKDL isolates belonged to transcribed regions that may code for proteins.
Nucleotide sequence analysis
The cloned fragments which were found to contain transcribed sequences were subjected to sequence analysis and the BLAST analysis revealed that transcripts were homologous with known or predicted genes in the L. infantum annotated genome database.
Sequences of P-520, P-300 and P-450 drew homology with iron superoxide dismutase fesod (LinJ32.2230), 3′ UTR of a putative gene phosphodiesterase (LinJ18·1100) and 5′ UTR of DEAD box RNA helicase (LinJ36.4680), respectively. These sequences were submitted to GenBank and assigned Accession numbers EF032817, EF032816, EF032815 respectively. Sequences of P-1.1 and P-0.7 in BLAST analysis depicted homology to 3′ UTR of LinJ33.2760 coding for a hypothetical protein of unknown function and to 5′ UTR and partial ORF of LinJ18.1040 another conserved hypothetical protein, respectively (GenBank Accession nos. EF032814; EF032818) (Table 1).
Table 1. Identity and expression pattern of genes corresponding to polymorphic fragments generated by AP-PCR analysis
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary-alt:20160629081836-01002-mediumThumb-S0031182007003484_tab1.jpg?pub-status=live)
Expression analysis of FeSOD
The Fesodb gene is classified into 2 types, fesodb1 and fesodb2, both having homologous sequences and are distinguishable by their UTRs (Plewes et al. Reference Plewes, Stephen and Gedamu2003). The expression of both was found to be stage specific; fesodb1 expression was upregulated in the amastigote stage by 1·5±0·1-fold while fesodb2 was overexpressed in the promastigote stage by 3·0±0·2-fold (Fig. 4A). Investigation of fesodb1 and fesodb2 expression at mid-log, late-log and stationary phase of the PKDL promastigotes, using UTR specific primers revealed that fesodb1 expression increased in intensity from the mid-log promastigotes to the stationary stage as shown by the 1·8 kb amplification product; in contrast, RT-PCR analysis using the specific 3′ UTR of fesodb2 revealed a single band of 1·6 kb that increased in intensity from mid-log to late-log phase and then decreased in the stationary stage. cDNA was normalized using the constitutively expressed α-tubulin gene of Leishmania (Fig. 4B).
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary-alt:20160629081455-95261-mediumThumb-S0031182007003484_fig4g.jpg?pub-status=live)
Fig. 4. Differential expression analysis of fesodb1 and b2 by semi-quantitative RT-PCR. (A) RTPCR analysis using cDNA from promastigotes and amastigotes of P1 and LdK1. (B) Analysis at mid-log, late-log and stationary phase of the PKDL promastigotes. cDNA was PCR amplified with α-tubulin for normalization of RNA levels.
Detection of DEAD box RNA helicase in lesion tissue
Presence of gene transcripts coding for DEAD box RNA helicase in parasite-infected lesion tissues was investigated since the gene had shown upregulation in the amastigote stage. The transcripts corresponding to ORF of Leishmania DEAD box RNA helicase (1·7 kb) were demonstrated by RT-PCR in RNA extracted from human bone marrow of KA patients and in skin lesions of PKDL patients, while the uninfected control samples did not show the amplification of parasite-specific DEAD box RNA helicase (Fig. 5).
![](https://static.cambridge.org/binary/version/id/urn:cambridge.org:id:binary-alt:20160629081549-12449-mediumThumb-S0031182007003484_fig5g.jpg?pub-status=live)
Fig. 5. Expression analysis of DEAD box RNA helicase by semi-quantitative RT-PCR in lesion tissue. Leishmania specific DEAD box RNA helicase was amplified from cDNA synthesized using total RNA isolated from bone marrow of KA (KABM) and skin lesions of PKDL (PKDL skin). Control BM and skin samples were taken from uninfected individual's bone marrow and skin biopsy, respectively. HPRT human house keeping gene (huHPRT) was used for normalization.
DISCUSSION
Leishmaniasis has forced itself upon medical attention as an increasingly significant problem over the last decade and is considered by WHO as one of the 6 tropical diseases in Category 1 for which the most important research needs are new basic knowledge and better intervention tools (Remme et al. Reference Remme, Blas, Chitsulo, Desjeux, Engers, Kanyok, Kayondo, Kioy, Kumaraswami, Lazdins, Nunn, Oduola, Ridley, Toure, Zicker and Morel2002). Parasites belonging to the genus Leishmania have a wide geographical distribution and cause different clinical manifestations including cutaneous, mucocutaneous and visceral pathology. Considerable research has focused mainly on pathogenesis and management of PKDL, leaving unexplored the important issues such as the parasite genetic factors responsible for the pathology. The gross differences in the spectrum of clinical manifestations (Ramesh and Mukherjee, Reference Ramesh and Mukherjee1995; Zijlstra et al. Reference Zijlstra, Musa, Khalil, El-Hassan and El-Hassan2003), humoral immune responses apparent in the KA and PKDL phenotypes (Salotra et al. Reference Salotra, Raina and Ramesh1999; Saha et al. Reference Saha, Mazumdar, Anam, Ravindran, Bairagi, Saha, Goswami, Pramanik, Guha, Kar, Banerjee and Ali2005) are, at least in part, a consequence of the alterations in the expression pattern of a multitude of parasite genes. In the present report we have employed AP-PCR for the genomic fingerprinting of Indian isolates of L. donovani obtained from PKDL patients originating from the endemic region and to identify differentially expressed genes in promastigote and amastigote stages of the parasite. Our earlier study using arbitrary primers for fingerprinting of Indian KA isolates revealed 2 divergent classes with the majority of KA isolates giving the same pattern as standard isolates LdAG83 and LdDD8 (Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b). The present study revealed that AP-PCR profiles with 4 oligos displayed a high degree of similarity within the Indian isolates of PKDL, which were quite similar to the predominant KA isolates.
An earlier AP-PCR approach has been exploited in surveying the Leishmania genome for gene sequences of interest and several classes of differentially expressed genes in L. donovani strains have been identified (Pogue Reference Pogue, Koul, Lee, Dwyer and Nakhasi1995a, Reference Pogue, Lee, Koul, Dwyer and Nakhasib; Selvapandiyan et al. Reference Selvapandiyan, Duncan, Debrabant, Bertholet, Sreenivas, Negi, Salotra and Nakhasi2001; Sreenivas et al. Reference Sreenivas, Singh, Selvapandiyan, Negi, Nakhasi and Salotra2004b). The amplification patterns in AP-PCR are sensitive to the primer and template concentration (Pogue et al. Reference Pogue, Koul, Lee, Dwyer and Nakhasi1995a). We identified polymorphic fragments in PKDL isolates in comparison with KA isolates upon changing the template concentration. The bands identified by AP-PCR were considered polymorphic if they were unique or quantitatively different in PKDL isolates in comparison with KA isolates. This approach led to identification of 6 polymorphic fragments, of which 5 were found to be representing transcribed sequences upon Northern analysis. Comparative expression analysis of all the fragments by Northern blot revealed that the majority (4/5) of them were differentially expressed in pro- and amastigote stages of the parasite. The fold differences observed for various genes studied here were found to be between 1·5- and 2·5-fold, which are similar to those reported earlier using genomic microarray studies for transcriptome analysis at promastigotes and amastigote stages in Leishmania (Akopyants et al. Reference Akopyants, Matlibs, Bukanova, Smeds, Brownstein, Stormo and Beverley2004; Srividya et al. Reference Srividya, Duncan, Sharma, Subbaraju, Nakhasi and Salotra2007).
One such gene that showed significantly higher expression in the promastigote stage of the parasite corresponded to iron superoxide dismutase (fesod). Leishmania species possess 2 types of fesod, fesoda and fesodb (Paramchuk, Reference Paramchuk, Ismail, Bhatia and Gedamu1997). fesoda, is a single copy gene, whereas the other gene, fesodb, belongs to a multi-gene family. Transcript levels and enzyme activities of fesoda and fesodb show differential stage expression, with higher levels present in the amastigote compared to the promastigote stage (Ghosh et al. Reference Ghosh, Goswami and Adhya2003). Further, fesoda deficiency has been shown to markedly reduce the survival of Leishmania amastigotes in mouse macrophages (Ghosh et al. Reference Ghosh, Goswami and Adhya2003). The role of superoxide dismutases in the intra-macrophage survival of Leishmania spp. remains to be established. Our observation of the high level of expression of Ldfesodb2 in the early logarithmic promastigote stage in Indian isolates of L. donovani suggests that the gene may be important for survival within the mid-gut of the sandfly, and the high level of expression of Ldfesodb1 in the stationary promastigote and amastigote stages suggests that it may be important for survival within macrophages by controlling endogenous superoxide levels.
Another stage-regulated gene identified was homologous to DEAD box RNA helicase. RNA helicases play a central role in the control of ribonucleic acid metabolism, regulate RNA unwinding and secondary structure in an ATP-dependent manner in vitro and control mRNA stability and protein translation. A recent study at the proteomic level has demonstrated a 2-fold upregulation of RNA helicase at protein level in the amastigote stage of L. infantum, similar to our observation at the transcriptomic level (McNicoll et al. Reference McNicoll, Drummelsmith, Muller, Madore, Boilard, Ouellette and Papadopoulou2006). The presence of its transcripts in the clinical samples derived from bone marrow of KA and dermal lesions of PKDL patients demonstrated in the present study indicate its role in the pathogenesis of the disease and its potential as a diagnostic tool. The lower expression of this gene in PKDL tissue lesion in comparison to KA bone marrow may be attributed to the scanty parasite load in the skin.
The gene corresponding to putative 3′-5′ cyclic nucleotide phosphodiesterase, was found to be upregulated in the promastigote stage in L. donovani. TbPDE1, a non-essential enzyme in Trypanosoma brucei (Gong et al. Reference Gong, Kunz, Zoraghi, Kunz, Brun and Seebeck2001), may represent a modulatory element of the cAMP signalling pathways of T. brucei, and its physiological roles remain to be explored both in Trypanosoma and Leishmania. Confocal laser scanning of T. cruzi epimastigotes showed its association with the plasma membrane and concentrated in the flagellum of the parasite. The localization of this enzyme is a unique feature that distinguishes it from all the trypanosomatid phosphodiesterases described so far and indicates that compartmentalization of cAMP phosphodiesterases could be important in these parasites (D'Angelo et al. Reference D'Angelo, Sanguineti, Reece, Birnbaumer, Torres and Flawia2004). The polymorphic fragment P-1100 corresponded to a hypothetical protein of 82·2 kDa with a transmembrane domain that showed significantly higher expression in the amastigote stage in comparison to the promastigote stage.
The stage-regulated expression of genes reported here in both PKDL and KA isolates, suggests that their in-depth study would provide important insights into the differences in the parasite factors responsible for manifestation of disease by Leishmania donovani. Further investigation on their function and contribution in the parasite life-cycle and infection process are warranted.
Financial assistance from the Department of Science and Technology, India is gratefully acknowledged. R. S. is grateful to CSIR, India for a Research Fellowship.