Introduction
Entomopathogenic nematodes (EPNs) or insect-parasitic nematodes in the genera Heterorhabditis and Steinernema are symbiotically associated with bacteria Photorhabdus and Xenorhabdus, respectively (Shapiro-Ilan et al., Reference Shapiro-Ilan, Hazir, Glazer and Lacey2017). During their complex life cycle, the infective juveniles (IJs) of EPNs living in the soil penetrate the larval stage of their insect hosts via a natural opening (mouth, spiracle, anus) or the soft cuticle. Upon entering the insect host, the IJs of EPNs release symbiotic bacteria, which multiply rapidly and produce secondary metabolites. The infected insect host dies within 24–48 h (Dowds & Peters, Reference Dowds, Peters and Gaugler2002). Together, the EPNs and their symbiotic bacteria feed on the bioconverted insect host. EPNs reproduce in the insect cadaver for 2–3 generations. The IJs feed on the symbiotic bacteria; when the food is depleted, a new cohort of IJs that carry symbiotic bacteria emerges from the cadaver in search of new insect hosts. Therefore, EPNs have been used as biocontrol agents for several species of insect pests (Smart, Reference Smart1995; Lacey et al., Reference Lacey, Grzywacz, Shapiro-Ilan, Frutos, Brownbridge and Goettel2015). These applications are safe for humans and the environment.
The presence of EPNs and their symbiotic bacteria has been globally reported at a variety of ecological habitats around the world, except Antarctica (Hominick, Reference Hominick and Gaugler2002). Biotic and abiotic characteristics are important factors for EPN survival in ecological niches. Soil parameters such as texture, pH, moisture and temperature are particularly important for the survival of EPNs. Geographical areas, habitats and soil properties are parameters that determine the diversity and distribution of EPNs. Several surveys of EPNs from different geographical ecologies have yielded variable recovery rates. To date, over 100 species of EPNs (Hunt, Reference Hunt, Hunt and Nguyen2016) and approximately 30 species of their symbiotic bacteria (Tailliez et al., Reference Tailliez, Laroui, Ginibre, Paule, Pages and Boemare2010, Tailliez et al., Reference Tailliez, Pages, Edgington, Tymo and Buddie2012; Ferreira et al., Reference Ferreira, van Reenen, Endo, Sproer, Malan and Dicks2013; Kuwata et al., Reference Kuwata, Qiu, Wang, Harada, Yoshida, Kondo and Yoshiga2013) have been described. In Thailand, approximately ten species of EPNs have been reported in several different habitats (Stock et al., Reference Stock, Somsook and Reid1998; Maneesakorn et al., Reference Maneesakorn, Grewal and Chandrapatya2010; Thanwisai et al., Reference Thanwisai, Tandhavanant, Saiprom, Waterfield, Ke Long, Bode and Chantratita2012; Vitta et al., Reference Vitta, Yimthin, Fukruksa, Wongpeera, Yotpanya, Polseela and Thanwisai2015, Reference Vitta, Fukruksa, Yimthin, Deelue, Sarai, Polseela and Thanwisai2017; Muangpat et al., Reference Muangpat, Yooyangket, Fukruksa, Suwannaroj, Yimthin, Sitthisak and Thanwisai2017; Yooyangket et al., Reference Yooyangket, Muangpat, Polseela, Tandhavanant, Thanwisai and Vitta2018; Suwannaroj et al., Reference Suwannaroj, Yimthin, Fukruksa, Muangpat, Yooyangket, Tandhavanant, Thanwisai and Vitta2020).
The identification of indigenous EPNs and symbiotic bacteria is ideal for the use of EPNs as biocontrol agents in local areas. Several attempts have been made to use indigenous EPNs in controlling insect pests such as the Caribbean fruit fly (Heve et al., Reference Heve, El-Borai, Carrillo and Duncan2017), termite (Al-Zaidawi et al., Reference Al-Zaidawi, Karimi and Mahdikhani2020) and house fly (Arriaga & Cortez-Madrigal, Reference Arriaga and Cortez-Madrigal2018). The areas surveyed for EPNs and symbiotic bacteria in Thailand were mainly on roadside verges and banks of ponds or rivers. Although surveys of EPNs and their associated bacteria have been conducted in several regions, the EPNs in the agricultural areas of Thailand had not yet been studied. Accordingly, we determined that information regarding the relationship between ecological factors and soil-dwelling EPNs would be useful for the application of EPNs as biological control agents in these specific areas. Therefore, we conducted a survey of EPNs in the agricultural areas of the Phitsanulok province in lower northern Thailand. Molecular identification of the EPNs and symbiotic bacteria was performed. In addition, the association between soil parameters and soil samples based on the presence or absence of EPNs was evaluated. The present study may help further the efforts in basic science for the further application of EPNs in local areas of Thailand.
Materials and methods
Soil collection
A total of 200 soil samples from 40 sites were collected from agricultural areas in the Phitsanulok province between February and March 2018 (fig. 1). Soil collection was performed using methods previously described by researchers in the field (Yooyangket et al., Reference Yooyangket, Muangpat, Polseela, Tandhavanant, Thanwisai and Vitta2018). Soil sites were randomly selected from several agricultural areas. The agricultural areas were defined into three main groups according to the species of plants present: (1) field crops, (2) horticultural crops and (3) forest area (table 1). Approximately 300–500 g of each soil sample was collected using a hand shovel. Soil parameters, including pH, temperature, texture and moisture, were recorded. The altitude, latitude and elevation of each soil site were determined using a GPS navigator (Garmin nüvi 1250, Garmin, New Taipei, Taiwan). Soil samples were transported under ambient temperature to the Department of Microbiology and Parasitology, Faculty of Medical Science, Naresuan University, Thailand.
Fig. 1. Map of the Phitsanulok province in Thailand where samples from 40 soil sites in agriculture areas were collected to search for EPNs. Twelve soil sites are positive for Steinernema (filled circle), and 28 sites are negative for the EPNs (blank circle).
Table 1. Prevalence of entomopathogenic nematodes in the agricultural areas of Phitsanulok province, Thailand.
Isolation and identification of EPNs
The IJ EPNs were isolated from the soil samples using the Galleria mellonella baiting technique. Galleria mellonella, the greater wax moth, was maintained with artificial food (wheat flour 200 g, honey 100 ml, glycerol 100 ml and instant dry yeast 50 g) in the laboratory. The White trap technique was used to obtain the emerging IJs from the G. mellonella cadaver (White, Reference White1927). The IJs were collected and cleaned with sterile distilled water and then kept at −20°C for genomic DNA extraction.
Genomic DNA from the IJ nematodes was extracted using Phire Tissue Direct PCR Master Mix (ThermoFisher Scientific, Carlsbad, California, USA), according to the manufacturer's instructions but with some modifications. The dilution and storage protocol was performed via reduction steps for nucleotide extraction. Approximately 200–500 IJs of EPN in a 1.5 ml microcentrifuge tube were mixed with 20 μl dilution buffer, and the DNARelease additive (0.5 μl) was added to the tube. To break the cells, a 200 μl tip was used to crush the nematode, and the reaction was mixed by vortexing. The tubes were incubated at room temperature for 2–5 min. Subsequently, the tubes were placed in a 95°C water bath for 5 min. The tubes were then centrifuged at 12,000 g for 1 min. The supernatant containing genomic DNA was collected and kept at −20°C prior to the polymerase chain reaction (PCR).
PCR was performed to amplify the 28S ribosomal DNA (rDNA) region using a primer pair: 539_F (5′GGATTTCCTTAGTAACTGCGAGTA-3′) and 535_R (5′-TAGTCTTTCGCCCCTATACCCTT-3′) (Stock et al., Reference Stock, Campbell and Nadler2001). The PCR reaction (30 μl) contained 15 μl of 2X Phire Tissue Direct PCR Master Mix (1X), 1.2 μl of 5 μM forward primer (0.8 μM), 1.2 μl of 5 μM reverse primer (0.8 μM), 1.8 μl of DNA template (100–200 ηg) and 10.8 μl of sterile distilled water. Thermocycling was done in a Biometra TOne thermal cycler (Analytik Jena AG, Jena, Germany) as follows: initial denaturation at 95°C for 5 min; followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 30 sec, and extension at 72°C for 45 sec; and a final extension at 72°C for 7 min. In addition, a partial sequence of the internal transcribed spacer (ITS) was amplified using a pair of primers: TW81_F (5′- GTTTCCGTAGGTGAACCTGC -3′) and AB28_R (5′- ATATGCTTAAGTTCAGCGGGT -3′) (Hominick et al., Reference Hominick, Briscoe and Del Pino1997). The PCR reaction (30 μl) was of the same volume and concentration as that of the 28S rDNA with the exception of the primers. Thermocycling was performed using a Biometra TOne Thermal cycler (Analytik Jena AG, Jena, Germany) as follows: initial denaturation at 98°C for 5 min; followed by 35 cycles of denaturation at 98°C for 5 sec, annealing at 55°C for 5 sec, and extension at 72°C for 30 sec; and a final extension at 72°C for 1 min. The 1.2% agarose gel electrophoresis was performed at a constant current of 100 V. Subsequently, the gel was stained with ethidium bromide, destained with distilled water and visualized and photographed under ultraviolet light. The PCR products were purified using a NucleoSpin® Gel and PCR Clean-Up Kit (Macherey-Nagel, Düren, Germany), according to the manufacturer's instructions. For nucleotide sequencing in both the forward and reverse directions, the purified PCR products were transported to Macrogen Inc., Seoul, Korea.
Isolation and identification of symbiotic bacteria
Isolation of symbiotic bacteria was performed as previously described in the literature (Yooyangket et al., Reference Yooyangket, Muangpat, Polseela, Tandhavanant, Thanwisai and Vitta2018). The symbiotic bacteria were isolated from the haemolymph of a G. mellonella cadaver, which had been infected with the IJs. A sterile loop was used to touch the haemolymph, and it was streaked on nutrient agar supplemented with bromothymol blue and triphenyl-2,3,5-tetrazolium chloride (NBTA). Colonies of symbiotic bacteria were observed on the NBTA plates after four days of incubation in the dark at room temperature. A single colony of each isolate of symbiotic bacteria was inoculated into 3 ml of Luria-Bertani broth and incubated with shaking at 180 rpm overnight (approximately 18–24 h). The genomic DNA of the symbiotic bacteria was extracted from the bacterial pellets using the Blood/Cell DNA Mini Kit (Geneaid Biotech Ltd., New Taipei, Taiwan). The genomic DNA of the symbiotic bacteria was stored at –20°C for further use in PCR. Analysis of the recombinase A (recA) gene sequence was performed to identify the symbiotic bacteria. The pair of primers used were recA_F (5′-GCTATTGATGAAAATAAACA-3′) and recA_R (5′–RATTTTRTCWCCRTTRTAGCT-3′) (Tailliez et al., Reference Tailliez, Laroui, Ginibre, Paule, Pages and Boemare2010). A total volume of 30 μl of the PCR reagents was used, containing 15 μl of EconoTaq® PLUS 2X Master Mix (1X) (Lucigen, Middleton, Wisconsin, USA), 1.5 μl of 5.0 μM recA_F primer (1.0 μM), 1.5 μl of 5.0 μM recA_R primer (1.0 μM), 1.5 μl of DNA template (100–200 ηg) and 10.5 μl of sterile distilled water. The PCR parameters for symbiotic bacteria were followed based on a previous description in Yooyangket et al. (Reference Yooyangket, Muangpat, Polseela, Tandhavanant, Thanwisai and Vitta2018). Thermocycling was performed using a Biometra TOne Thermal cycler (Analytik Jena AG, Jena, Germany). Agarose gel electrophoresis was performed with constant 100 V current. The PCR products were visualized on ethidium-bromide-stained 1.2% agarose gel. The method used for the purification of the PCR products was similar to that used to identify the EPNs. The nucleotide sequencing for each direction (forward and reverse) was also analysed by Macrogen Inc. in Korea.
Analysis of sequences and construction of phylogeny
All the sequences were edited by viewing the peak of the chromatogram in SeqMan II software (DNASTAR, Madison, Wisconsin, USA). The nucleotide sequences were aligned using ClustalW. The identified EPN and symbiotic bacteria species were confirmed by a BLASTN search in the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi), with a nucleotide similarity above 97% being considered significant. Maximum likelihood (ML) and neighbour-joining (NJ) trees were constructed based on the Tamura–Nei and Kimura two-parameter models, respectively, and run on MEGA version 7.0 (Kumar et al., Reference Kumar, Stecher and Tamura2016). In addition, Bayesian analyses were performed using the Markov chain Monte Carlo method in MrBayes version 3.2 (Ronquist et al., Reference Ronquist, Teslenko, Van Der Mark, Ayres, Darling, Höhna, Larget, Liu, Suchard and Huelsenbeck2012). Although three methods were followed to construct a phylogeny, only ML topology is shown in the present study. The bootstrap values from two methods and the percentage of Bayesian posterior probabilities are indicated on the branch of the ML tree.
Statistical analysis
The soil parameters (soil temperature, soil pH and soil moisture) and elevation level of each agricultural area were statistically analysed for the groups with positive or negative indications for the presence of EPNs, and SPSS version 17 was used for the same (SPSS Inc., Chicago, IL). Multivariable (soil parameters and elevation) logistic regression was carried out to calculate the odds ratios (ORs) and 95% confidence interval (CI), considering the presence of EPNs as the main outcome. In addition, the association between soil texture and presence of EPNs was statistically analysed using the Fisher's exact test. Each agricultural area was also statistically analysed using the Fisher's exact test. The differences between the two groups were considered to be statistically significant if the P-value was <0.05.
Results
Prevalence and molecular identification of EPNs
A total of 40 soil sites tested; 12 sites were positive (30%) and 16 out of 200 soil samples (8.0% prevalence) were positive for EPNs (table 1). All the isolates were primarily identified as belonging to the genus Steinernema. Based on the 549 bp of the nucleotide in the 28S rDNA region, 15 of the Steinernema isolates were identified as Steinernema siamkayai, with 99.82% identity to S. siamkayai strain CS33 (accession number MN194613). The one remaining sequence was not included for analysis due to its short length. The sequences of Steinernema in the present study were deposited in the NCBI database with accession numbers MT478151–MT478165. Based on the ML tree, all the sequences in the present study were grouped with S. siamkayai, S. capocapsae, S. huense and S. surkhetense (fig. 2). In addition, nine isolates of Steinernema (accession numbers MT872205–MT872213) were analysed based on 671 bp of the nucleotide in the ITS region. These ITS sequences showed the highest similarities (99.55–99.70%) with S. siamkayai (accession number GQ377414). Also, the ML tree based on the ITS region showed similar topology with the 28S rDNA region, due to which all the nine sequences in the present study were grouped with S. siamkayai, S. capocapsae, S. huense and S. surkhetense (fig. 3).
Fig. 2. Topology of maximum-likelihood phylogenetic tree based on 549 nucleotides of a partial region of the 28S rRNA gene from 15 Steinernema isolates in the present study together with several Steinernema species retrieved from the NCBI database. Support values (ML bootstrap/NJ bootstrap/Bayesian posterior probabilities) are shown above the branches, and a dash (–) instead of a numerical support value indicates that a certain grouping was not seen by that method of analysis. Bold letters indicate the sequences obtained in the present study. Caenorhabditis elegans or C. elegans (accession number JN636101) was included in the phylogeny as the outgroup. Scale bar shows 20% sequence divergence.
Fig. 3. Topology of maximum-likelihood phylogenetic tree based on 671 nucleotides of a partial ITS region from nine Steinernema isolates in the present study together with several Steinernema species retrieved from the NCBI database. Support values (ML bootstrap/NJ bootstrap/Bayesian posterior probabilities) are shown above the branches, and a dash (–) instead of a numerical support value indicates that a certain grouping was not seen by that method of analysis. Bold letters indicate the sequences obtained in the present study. Caenorhabditis elegans or C. elegans (accession number KX572972) was included in the phylogeny as the outgroup. Scale bar shows 10% sequence divergence.
Isolation and molecular identification of symbiotic bacteria
Seven isolates of Xenorhabdus bacteria were identified based on their colony morphology on the NBTA agar. All the isolates in the present study were identified, based on 577 bp of a partial recA sequence, as Xenorhabdus stockiae. This showed that identity ranged from 98.96 to 99.83% with the X. stockiae strain TH01 (accession number FJ823425) and X. stockiae strain CS33 (accession number MK401900) after a BLASTN search. All the nucleotide sequences of Xenorhabdus in the present study were deposited in the NCBI database with accession numbers MT465733–MT465739. The ML tree represents all Xenorhabdus isolates closely related to X. stockiae (accession number FJ823425) (fig. 4).
Fig. 4. Topology of a maximum-likelihood phylogenetic tree based on 577 nucleotides of a partial region of the recA gene of 7 Xenorhabdus isolates in the present study as well as several Xenorhabdus species retrieved from the NCBI database. Support values (ML bootstrap/NJ bootstrap/Bayesian posterior probabilities) are shown above the branches, and a dash (–) instead of a numerical support value indicates that a certain grouping was not seen by that method of analysis. Bold letters indicate the sequences obtained in the present study. Escherichia coli (accession number U00096), a bacterial species in the same family (Enterobacteriaceae) as Xenorhabdus, was included in the phylogeny as the outgroup. Scale bar shows 2% sequence divergence.
Association between soil parameters and EPNs
The soil samples that were positive for the presence of EPNs were found in loam, sandy loam and clay loam soil types. In contrast, clay soil samples collected in the present study were found to be negative for EPNs (table 2). Significantly more EPNs were recovered from loam than from clay (Fisher's exact test; P = 0.038) and from clay loams than from clay (Fisher's exact test; P = 0.04). The parameters for the soil samples (temperature, pH and moisture) showed no significant difference between the positive and negative EPNs (table 3). In contrast, the elevation levels of the soil samples with EPNs (n = 16, mean ± standard deviation (SD) = 46.5 ± 3.57, range = 40–55) or without EPNs (n = 184, mean ± SD = 42.4 ± 6.4, range = 22–55) were significantly different (logistic regression test; P = 0.02, OR = 1.13, 95% CI = 1.01–1.27).
Table 2. Prevalence of entomopathogenic nematodes by soil texture.
Table 3. The association between soil parameters and the presence of EPNs.
OR, odds ratio; 95% CI, 95% confidence interval; SD, standard deviation.
Association between agricultural areas and EPNs
Table 4 presents the relationship between agricultural areas and the presence of EPNs in the Phitsanulok province of Thailand. Most of the EPNs were recovered from field crop areas (10.8%), and a few samples positive for EPNs were recovered from horticultural crops (4.0%). Among the field crop sites, soil samples collected from the corn field, rice field, cassava plantation and bonavista bean plantation were positive for EPNs. Of the horticultural crops, soil samples from the ivy gourd and banana plantations were positive for EPNs. Half of the soil samples positive for EPNs were found in corn field areas (table 1). The soil samples from the horticultural and field crop areas could not be correlated to the presence or absence of EPNs (Fisher's exact test; P = 0.073) (table 4).
Table 4. The association between agricultural areas and the presence of EPNs.
Discussion
In 1998, S. siamkayai was initially isolated from soil samples of sweet tamarind orchards in the Phetchabun province of Thailand (Stock et al., Reference Stock, Somsook and Reid1998). Subsequently, this species was reported in India and Nepal also (Banu et al., Reference Banu, Nguyen and Rajendran2005; Khatri-Chhetri et al., Reference Khatri-Chhetri, Waeyenberge, Manandhar and Moens2010; Raja et al., Reference Raja, Sivaramakrishnan and Hazir2011). Herein, we have reported that S. siamkayai was isolated from agricultural areas, and none of the genus Heterorhabditis was recovered. This may be because there are more species of Steinernema than Heterorhabditis nematodes, and, therefore, the former species is distributed in several habitats. In 2016, over 90 species of Steinernema were formally described, while approximately 15 species of Heterorhabditis were recorded across the world (Hunt, Reference Hunt, Hunt and Nguyen2016). The prevalence of S. siamkayai in the present study was 8.0% in the agricultural areas of Thailand. Further, S. siamkayai have previously been isolated from agricultural areas in Nepal (Khatri-Chhetri et al., Reference Khatri-Chhetri, Waeyenberge, Manandhar and Moens2010). To support this status, the abundance of the EPNs was associated with ecological habitats in which the human impact is considerable, such as agricultural fields (Mráček & Webster, Reference Mráček and Webster1993; Shahina et al., Reference Shahina, Anis, Zainab and Maqbool1998). In previous studies, more isolates of Steinernema (than Heterorhabditis) were reported in Thailand (Vitta et al., Reference Vitta, Fukruksa, Yimthin, Deelue, Sarai, Polseela and Thanwisai2017; Yooyangket et al., Reference Yooyangket, Muangpat, Polseela, Tandhavanant, Thanwisai and Vitta2018); however, some EPN surveys found more Heterorhabditis isolates than Steinernema isolates (Vitta et al., Reference Vitta, Yimthin, Fukruksa, Wongpeera, Yotpanya, Polseela and Thanwisai2015; Muangpat et al., Reference Muangpat, Yooyangket, Fukruksa, Suwannaroj, Yimthin, Sitthisak and Thanwisai2017). Therefore, the occurrence of Heterorhabditis and Steinernema may be associated with several factors, although these factors have not been delineated. Up to ten species of EPNs were reported from several ecological habitats (roadside verge, riverbank and national park) of Thailand. These EPNs were Steinernema surkhetense, Steinernema websteri (synonym Steinernema carpocapsae), Steinernema scarabiae, Steinernema kushidai, Steinernema minutum and Steinernema khoisanae and Heterorhabditis indica (synonym Heterorhabditis gerrardi), Heterorhabditis baujardi (synonym Heterorhabditis somsookae), Heterorhabditis bacteriophora and Heterorhabditis zealandica (Maneesakorn et al., Reference Maneesakorn, Grewal and Chandrapatya2010; Thanwisai et al., Reference Thanwisai, Tandhavanant, Saiprom, Waterfield, Ke Long, Bode and Chantratita2012; Fukruksa et al., Reference Fukruksa, Yimthin, Suwannaroj, Muangpat, Tandhavanant, Thanwisai and Vitta2017; Muangpat et al., Reference Muangpat, Yooyangket, Fukruksa, Suwannaroj, Yimthin, Sitthisak and Thanwisai2017; Vitta et al., Reference Vitta, Fukruksa, Yimthin, Deelue, Sarai, Polseela and Thanwisai2017; Yooyangket et al., Reference Yooyangket, Muangpat, Polseela, Tandhavanant, Thanwisai and Vitta2018). Heterorhabditis zealandica and S. kushidai are isolates from the soil of the forest native to Mae Wong National Park in Thailand. The most common species of EPNs found in the country were S. surkhetense and H. indica. However, these two species were not found in the present study. This may be due to differences in several factors such as life cycle, insect host abundance and habitat. The preferential survey of EPNs in agricultural areas may be one factor which results in more positive samples. Therefore, S. siamkayai may be frequently found in the agricultural areas. In Portugal, Steinernema feltiae was mostly recovered in agricultural land (Valadas et al., Reference Valadas, Laranjo, Mota and Oliveira2014). Also noted in Italy were S. feltiae and H. bacteriophora, which were found to be related with vegetation habitat (Tarasco et al., Reference Tarasco, Clausi and Rappazzo2015). In Brazil, Heterorhabditis amazonensis, Metarhabditis rainai, Oscheius tipulae and Steinernema rarum were isolated from soil in agricultural areas (de Brida et al., Reference de Brida, Rosa, Oliveira, Castro, Serrão, Zanuncio, Leite and Wilcken2017). Oscheius onirici was also isolated from a wild cranberry marsh in Jackson County, Wisconsin, USA (Ye et al., Reference Ye, Foye, MacGuidwin and Steffan2018). In addition, S. khoisanae, Steinernema yirgalemense, Steinernema citrae, H. bacteriophora, H. zealandica and Heterorhabditis sp. were recovered from citrus orchards in South Africa (Malan et al., Reference Malan, Knoetze and Moore2011). Steinernema abbasi, S. minutum, Steinernema tami and H. indica were found to be present in the agricultural and forested areas in the Philippines (Caoili et al., Reference Caoili, Latina, Sandoval and Orajay2018). Including in the present study, S. siamkayai was isolated from the field and horticulture crops. This indicates that EPNs have global abundance in agricultural areas. Further research on the application of these EPNs in specific agricultural areas will be performed to achieve a reduction of chemical use in the control of insect pests.
Although S. siamkayai was not evaluated for its biological activity in the present study, several reports on insecticidal activities of this EPN were experimentally tested against insect pests. Previous studies have shown that S. siamkayai has the potential to control Aedes aegypti, Anopheles stephensi, Culex quinquefasciatus (Dilipkumar et al., Reference Dilipkumar, Raja Ramalingam, Chinnaperumal, Govindasamy, Paramasivam, Dhayalan and Pachiappan2019), pulse beetle Callosobruchus chinensis (Fayyaz & Javed, Reference Fayyaz and Javed2009) and Spodoptera litura Fabricius (Wetchayunt et al., Reference Wetchayunt, Rattanapan and Phairiron2009). In general, the effective bioactivity of this organism against insect hosts is not restricted to its being an EPN, but also includes its bacterial symbionts. Steinernema siamkayai was associated with X. stockiae (Tailliez et al., Reference Tailliez, Pagès, Ginibre and Boemare2006), and our findings demonstrate that X. stockiae is also hosted by S. siamkayai. This may be a symbiont duo with high specificity. However, X. stockiae was also reported as a bacterial symbiont with S. surkhetense (Bhat et al., Reference Bhat, Singh and Vig2017), S. minutum (Maneesakorn et al., Reference Maneesakorn, Grewal and Chandrapatya2010) and S. huense (Phan et al., Reference Phan, Mráček, Půža, Nermut and Jarošová2014). These EPNs were closely related in terms of evolution (as indicated in the phylogeny), and X. stockiae could be symbiotically associated with these EPNs. Several strains of X. stockiae were reported as being potential microbial agents to control Ae. aegypti, Aedes albopictus, mushroom mites and cow Mastitis-causing bacteria (Bussaman et al., Reference Bussaman, Sa-Uth, Rattanasena and Chandrapatya2012; Namsena et al., Reference Namsena, Bussaman and Rattanasena2016; Fukruksa et al., Reference Fukruksa, Yimthin, Suwannaroj, Muangpat, Tandhavanant, Thanwisai and Vitta2017; Bussaman & Rattanasena, Reference Bussaman and Rattanasena2016; Vitta et al., Reference Vitta, Thimpoo, Meesil, Yimthin, Fukruksa, Polseela and Thanwisai2018; Yooyangket et al., Reference Yooyangket, Muangpat, Polseela, Tandhavanant, Thanwisai and Vitta2018). This indicates that EPNs and their symbiotic bacteria are effective against insect pests. Therefore, S. siamkayai and its symbiont X. stockiae have broadly effective bioactivity and may be alternative bio-agents for the control of insect pests.
Xenorhabdus stockiae was identified by recA sequencing. Several housekeeping genes have been reported as the genetic markers for taxonomic purposes. The 16S rRNA and 50S ribosomal protein L2 genes cannot discriminate at the species level, but they are useful for identification at the genus level (Tailliez et al., Reference Tailliez, Laroui, Ginibre, Paule, Pages and Boemare2010). It is possible that the glutamyl-tRNA synthetase is gained from lateral gene transfer (Tailliez et al., Reference Tailliez, Laroui, Ginibre, Paule, Pages and Boemare2010). In contrast, the DNA polymerase III subunit beta (dnaN) and recA sequences demonstrated correct clustering in the phylogenetic analysis. Therefore, the dnaN and recA sequences may be good genetic markers to differentiate the Xenorhabdus and Photorhabdus species (Tailliez et al., Reference Tailliez, Laroui, Ginibre, Paule, Pages and Boemare2010). In addition, recA is the most widely used marker for identification and phylogenetic analysis in Thailand (Thanwisai et al., Reference Thanwisai, Tandhavanant, Saiprom, Waterfield, Ke Long, Bode and Chantratita2012; Fukruksa et al., Reference Fukruksa, Yimthin, Suwannaroj, Muangpat, Tandhavanant, Thanwisai and Vitta2017; Muangpat et al., Reference Muangpat, Yooyangket, Fukruksa, Suwannaroj, Yimthin, Sitthisak and Thanwisai2017; Yooyangket et al., Reference Yooyangket, Muangpat, Polseela, Tandhavanant, Thanwisai and Vitta2018).
The presence or absence of EPNs in the soil samples could be affected by several factors such as the sampling method and isolation techniques used. Accordingly, the limitations of the present study in analysing the association between the soil factors and presence of EPNs could be due to, in part, the small number of samples and low recovery rate of the EPNs. We found only S. siamkayai (15 isolates) in the present study. Most of the positive samples with S. siamkayai were isolated from loam. Also, S. siamkayai (in Nepal) was recovered from silt loam and sandy loam (Khatri-Chhetri et al., Reference Khatri-Chhetri, Waeyenberge, Manandhar and Moens2010). This is consistent with other reports showing that the IJ of EPNs prefer soil with high sand content for their movements and survival (Hazir et al., Reference Hazir, Keskin, Stock, Kaya and Özcan2003; Kary et al., Reference Kary, Gholamreza, Christine, Seyed and Vahed2009). In the present study, the soil parameters (moisture, pH and temperature) were not significantly associated with the presence of EPNs in the samples. This could also be due to the small number of samples. Steinernema siamkayai was recovered at high pH (4–7), temperature (25–33°C) and moisture (1–8%) ranges. Similarly, S. siamkayai in Nepal was recovered from warm agricultural areas with soil pH of 4.1–7 (Khatri-Chhetri et al., Reference Khatri-Chhetri, Waeyenberge, Manandhar and Moens2010). This suggests that S. siamkayai in warm temperatures may widely occupy several niches. In addition, the elevation of soil sites was associated with the presence of EPNs (logistic regression test; P = 0.02, OR = 1.13, 95% CI = 1.01–1.27). Elevation could affect the distribution of EPN (Rosa et al., Reference Rosa, Bonifassi, Amaral, Lacey, Simões and Laumond2000). At lower altitudes, Heterorhabditis was most abundant in soil samples. Steinernema became more abundant above 300 m. The prevalence of Heterorhabditis at sea level and Steinernema above 300 m was high (Hara et al., Reference Hara, Gaugler, Kaya and LeBeck1991). This might be the reason for our finding of low prevalence of S. siamkayai, which was found at 20–55 above mean sea level. However, several factors may affect the distribution of the EPNs. Soil moisture, temperature and rainfall also affect the distribution of the insects that could possibly be hosts for the EPN (Kung et al., Reference Kung, Gaugler and Kaya1990; Garcia del Pino & Palomo, Reference Garcia del Pino and Palomo1996).
Steinernema siamkayai was recovered in soil samples from field and horticultural crop areas, with its presence being mostly found in corn fields. A few isolates of S. siamkayai were recovered from the rice fields, cassava plantation, bonavista bean plantation, ivy gourd plantation and banana plantation. This suggests that S. siamkayai may be used as a biocontrol agent for the control of insect pests in these areas, especially corn fields. A previous study used H. bacteriophora for controlling the larvae of western corn rootworm in maize crops (Modic et al., Reference Modic, Žigon, Kolmanič, Trdan and Razinger2020). Therefore, the application of S. siamkayai to control insect pests in corn fields may be feasible and potentially lead to the reduction of chemical insecticide use.
In summary, we identified S. siamkayai and their symbiotic bacteria X. stockiae in agricultural areas of Thailand. This EPN species was recovered from loam in field and horticultural crop areas with high pH, temperature and moisture ranges. Although the soil parameters and agricultural areas were not correlated with the presence or absence of EPNs, S. siamkayai has a potential application as a biocontrol agent in fields or horticultural crop areas.
Acknowledgements
We would like to thank the Department of Microbiology and Parasitology, Faculty of Medical Science, Naresuan University, Thailand, for provision of facilities. We would also like to thank Miss Buchita Samritnok, Miss Benchawan Ratsamee and Miss Prapasiri Waranuch for their help in soil collection.
Financial support
This work was supported by the Naresuan University Fund (grant number R2563C015).
Conflicts of interest
None.
Ethical standards
This article does not contain any studies with human or animal subjects performed by any of the authors.
