Hostname: page-component-745bb68f8f-grxwn Total loading time: 0 Render date: 2025-02-06T13:52:23.608Z Has data issue: false hasContentIssue false

Fibrillin-1 gene intron 56 polymorphism in Turkish children with mitral valve prolapse*

Published online by Cambridge University Press:  04 March 2010

Osman Ozdemir*
Affiliation:
Department of Paediatric Cardiology, Kecioren Training and Research Hospital, Ankara, Turkey
Rana Olgunturk
Affiliation:
Department of Paediatric Cardiology, Ankara, Turkey
Kadri Karaer
Affiliation:
Department of Medical Genetics, Gazi University, School of Medicine, Ankara, Turkey
Mehmet Ali Ergun
Affiliation:
Department of Medical Genetics, Gazi University, School of Medicine, Ankara, Turkey
Fatma Sedef Tunaoglu
Affiliation:
Department of Paediatric Cardiology, Ankara, Turkey
Serdar Kula
Affiliation:
Department of Paediatric Cardiology, Ankara, Turkey
Ferda Emriye Percin
Affiliation:
Department of Medical Genetics, Gazi University, School of Medicine, Ankara, Turkey
*
Correspondence to: Osman Ozdemir, Kecioren Egitim ve Arastirma Hastanesi, Sanatoryum Caddesi, Pinarbasi Mahallesi, Ardahan Sokak, No 1, Kecioren, Ankara, Turkey, 06280. Tel: +90 532 6281209; Fax: +90 312 3569002; E-mail: pedkard@gmail.com
Rights & Permissions [Opens in a new window]

Abstract

Objective

Mitral valvar prolapse is the most common anomaly of the mitral valve apparatus throughout childhood. Fibrillin is one of the structural components of the elastin-associated microfibrils found in the mitral valve. A case-controlled study has performed to investigate the relationship between fibrillin 1 gene intron 56 polymorphism and risk of mitral valvar prolapse in Turkish children.

Patients and methods

A total of 77 patients with mitral valvar prolapse diagnosed by clinical evaluation and echocardiography and 89 normal children of same age and sex were studied. The fibrillin-1 gene intron 56 polymorphism was identified by the polymerase chain reaction-based restriction analysis.

Results

There was a significant difference in the distribution of fibrillin-1 gene intron 56 genotypes (p = 0.0001) and allelic frequency (p = 0.0001) between the cases and the controls.

Conclusions

Patients with mitral valvar prolapse have higher frequencies of fibrillin-1 gene intron 56 GC genotypes. Healthy children have higher frequencies of fibrillin-1 gene intron 56 CC genotypes. We speculate that the higher frequency of fibrillin-1 gene intron 56 G-allele increases the risk of mitral valvar prolapse.

Type
Original Articles
Copyright
Copyright © Cambridge University Press 2010

Mitral valvar prolapse is one of the most common cardiac valvular diseases as well as the most common disorder of the mitral valve complex. It is characterised by the displacement of one or both mitral leaflets into the left atrium at the end of systole. Myxomatous degeneration of the valve leaflets is recognised as a characteristic histological change of mitral valvar prolapse.Reference Boudoulas, Sparks and Wooley1 According to recent community studies, it has an estimated prevalence of 2.4% in general population; thus, mitral valvar prolapse would be expected to be present in over 144 million worldwide.Reference Freed, Levy and Levine2 But, it is unknown whether its results are applicable to other ethnic and racial groups. To date, this question remains still unanswered. Its aetiology and pathophysiology are unclear, with genetic markers and biomarkers for the disease still in the process of being elucidated. Although most cases with mitral valvar prolapse appear to be sporadic, it is shown that familial form is transmitted with autosomal dominant heritage.Reference Disse, Abergel and Berrebi3Reference Nesta, Leyne and Yosefy5

Mitral valvar prolapse with or without mitral regurgitation has been documented to be more prevalent in patients with Marfan syndrome, Ehlers Danlos syndrome, osteogenesis imperfecta, and other collagen-related disorders.Reference Glesby and Pyeritz6 This association with inherited connective tissue disorders, plus the myxomatous degeneration observed in the mitral valves of patients showing mitral valvar prolapse, has suggested that the abnormality of some component of the connective tissue may be involved. The structural changes in the arrangement of both the amorphous elastin core and the microfibrils of elastic fibres associated with an increase in the number and a decrease in the size of the elastic fibres are examined in floppy areas of the mitral valvar prolapse. These alterations in the connective tissue of mitral valvar prolapse are involved in the pathological process.Reference Tamura, Fukuda, Ishizaki, Masuda, Yamanaka and Ferrans7

Fibrillin, which is a cysteine rich glycoprotein that weighs 350 kilograms Dalton and is composed of three similar forms, is the building stone of microfibrils in mitral valve. Coding of fibrillin-1 gene, fibrillin-2 and fibrillin-3 genes are done by 15q21, 5q23, and 19p13 chromosomes, respectively. Fibrillin-1 and fibrillin-2 genes are structurally similar and both contain 65 exons.Reference Robinson, Arteaga-Solis and Baldock8 Genetic variations of fibrillin-1 gene are known to cause Marfan syndrome. Phenotypes of other disorders similar to Marfan are seen with fibrillin-1 gene mutation. These disorders, including familial mitral valvar prolapse, Marfan syndrome, and neonatal Marfan syndrome, are called “type 1 fibrillinopathies”.Reference Robinson, Arteaga-Solis and Baldock8, Reference Loeys, Matthys and De Paepe9 Mutation of fibrillin-2 gene is held responsible for congenital contractural arachnodactyly. No phenotype associated with mutations in fibrillin-3 gene has been shown.Reference Robinson, Arteaga-Solis and Baldock8 Although very limited data are currently available regarding the role of fibrillin-1 gene polymorphisms in the pathogenesis of isolated mitral valvar prolapse, the current study was designed to determine whether the polymorphism of intron 56 of the fibrillin-1 gene is associated with risk of mitral valvar prolapse in Turkish children.

Materials and methods

Study population

This study was carried out the Department of Paediatric Cardiology in Gazi University, School of Medicine. A total of 77 patients (44 females and 33 males) with an echocardiographically diagnosed mitral valvar prolapse were enroled in this study. Diagnosis of mitral valvar prolapse was made by echocardiography. Patients with familial mitral valvar prolapse, Marfan syndrome, Ehlers Danlos syndrome, rheumatic cardiac disease, and congenital cardiac disease were excluded. The control group comprised 89 age- and sex-matched healthy children (49 females and 40 males) with a normal echocardiography verified before inclusion. All subjects were of Turkish ethnicity and lived in central Turkey.

All subjects signed an informed consent; the study complies with the Declaration of Helsinki and was approved by the local ethics committee.

Echocardiographic method

A ViVid 3 Expert echocardiography device of General Electric Medical Systems Company (Milwaukee, Wisconsin, United States of America) with 7 and 3 MegaHertz probes was used for echocardiographic examination of patients. Structure and movement of mitral valve in more than one position; parasternal long axis, and apical 4 cavity positions were evaluated. Displacement of anterior and/or posterior leaflet of mitral valve more than 2 millimetres towards left atrium and measurement of this leaflet in diastole over 5 millimetres is accepted as classic mitral valvar prolapse.Reference Freed, Benjamin and Levy10, Reference Mechleb, Kasasbeh, Iskandar, Schoondyke and Garcia11

Genetic analysis

Blood samples were obtained from the patients and put in tubes with ethylene diamine tetra-acetic acid. The tubes were protected to minus 20 degree Celsius. The genomic deoxyribonucleic acid was prepared from peripheral blood leucocytes using a genomic deoxyribonucleic acid isolation kit (Dr Zeydanli, Istanbul, Turkey). Analyses of the blood samples were blinded to our genetic laboratory.

The polymerase chain reaction technique was used to amplify specific regions of a deoxyribonucleic acid strand. The primers were designed according to the sequences of human fibrillin-1 gene, which were available on the web site (http://www.ncbi.nlm.nih.gov/). Primers for intron 56 polymorphism were (forward) 5′ CGAGTGCCTTGGTGAGTACA 3′ and (reverse) 5′ AATTTAGCTGCAGGGTGGTG 3′.

The polymerase chain reaction mixture contained 0.8 microlitre (0.3 micromole) of each primer, 0.8 microlitre (100 micromole) MgCl2, 1 microlitre (10 micromole) dNTPs, 5 microlitre (10×) polymerase chain reaction buffer, 0.3 microlitre (5 unit per 50 microlitre) Taq deoxyribonucleic acid polymerase, 4 microlitre (40 micromole) genomic deoxyribonucleic acid, and 37.3 microlitre deoxyribonuclease, and ribonuclease free water. The final reaction volume was 50 microlitre. Deoxyribonucleic acid was denatured at 94 degree Celsius for 5 minutes followed by 35 cycles of amplification beginning with a denaturation step at 94 degree Celsius, a primer annealing step at 60 degree Celsius, and an extension step at 72 degree Celsius, each step took 75 seconds. A 5-minutes final extension step was performed at 72 degree Celsius. After polymerase chain reaction, the fragment was digested by the restriction enzyme Aci I for the intron 56 polymorphism. So 15 microlitre polymerase chain reaction product, 1.6 microlitre buffer, and Aci I restriction enzymes were added in the ependorf tubes (0.5 millilitres) for each product. The polymorphisms on the fibrillin-1 gene were confirmed by electrophoresis of 8 microlitre reaction aliquot in 2% agarose gels, followed by visualisation of bands under ultraviolet light and photographed by Canon powershot G5 camera (Japan) with Syngene system.

Statistical method

The differences between ages were compared using “Student’s t-test” in the mitral valvar prolapse and control groups. The gender distributions were tested using a “χ2 test” in the groups. Genotypic differences and allelic frequencies of intron 56 between patients with mitral valvar prolapse and control subjects were compared using the “χ2 test”. The polymorphism of intron 56 of fibrillin-1 gene with “Hardy–Weinberg principle” was controlled using the “χ2 test” in the study. The associations between the intron 56 GC genotypes and mitral valvar prolapse risk were estimated by computing the odds ratios and their 95% confidence intervals. A p-value, less than 0.05, was considered statistically significant. All statistical analyses were performed using “SPSS for Windows”.

Results

Patient characteristics

The gender and age distributions of the patients and healthy control subjects were found similar and listed in Table 1.

Table 1 Gender and age distributions of patients with mitral valve prolapse and control groups.

MVP, Mitral valve prolapse

2 test

**Student’s t-test

Fibrillin-1 gene intron 56 polymorphism

A 170 plus 28 base pair band was seen in individuals with wild-type genotype when bands formed after electrophoresis was examined. A non-digested fragment was determined in individuals with mutant genotype (198 base pair; Fig 1).

Figure 1 Photograph of intron 56 taken with the camera including Syngene system.

As Table 2 indicates, homozygote genotype was determined in 32.5% of patients in mitral valvar prolapse group, and 70.8% of controls. Consequently, a statistical difference between groups in terms of fibrillin 1 gene intron 56 polymorphism was detected (χ2 = 24.335, p = 0.0001, odds ratio = 5.040, 95% confidence intervals = 2.604–9.756). Using Hardy–Weinberg method, allelic frequencies in terms of fibrillin-1 gene intron 56 polymorphism were found as 34% G-allele, 66% C-allele in mitral valvar prolapse group; and 15% G-allele, 85% C-allele in control group and a statistical difference (χ2 = 16.862, p = 0.0001, odds ratio = 2.980, 95% confidence intervals = 1.748–5.081) was determined between groups.

Table 2 Distribution of fibrillin-1 gene intron 56 polymorphism in patients with mitral valve prolapse and healthy control subjects.

CI, confidence interval; MVP, mitral valve prolapse; OR, odds ratio

2 test

Discussion

Mitral valvar prolapse is a complex clinical entity that has been well known for more than 45 years. It is generally understood to be the displacement of abnormally thickened, redundant mitral leaflet(s) into the left atrium during systole.Reference Boudoulas, Sparks and Wooley1, Reference Freed, Levy and Levine2 The main histological features of mitral valvar prolapse are marked proliferation of the spongiosa of the mitral valve leaflets and mucopolysaccharide acid replacement of leaflet collagen, causing myxomatous leaflet thickening and mitral leaflet redundancy.Reference Edwards12 The technique of echocardiography has evolved from transthoracic to transoesophageal and from one dimensional to three dimensional modes. Thus, the diagnosis of mitral valvar prolapse has become easier and more accurate.Reference Mechleb, Kasasbeh, Iskandar, Schoondyke and Garcia11 Primary mitral valvar prolapse can be familial or sporadic. Identification of the locus for autosomal dominant familial mitral valvar prolapse to chromosome 16p11.2-p12.1, 11p15.4, and 13q31.3-q32.1 have been reported.Reference Disse, Abergel and Berrebi3Reference Nesta, Leyne and Yosefy5 In addition, X-linked inheritance has been reported in a special form of familial mitral valvar prolapse, called myxomatous valvular dystrophy, which has been mapped to Xq28 in a large French pedigree.Reference Kyndt, Schott and Trochu13

During intrauterine life, differentiation of mitral valve and formation of chest cavity and bone structures in vertebrae occur in the fifth and the sixth weeks of pregnancy.Reference Edwards12 Therefore, disorders in mitral valve and connective tissue are accepted to be closely associated. As mitral valvar prolapse has been discovered, similarities with Marfan syndrome have been described. More recently, it has been estimated that only 0.25% of patients with mitral valvar prolapse have Marfan syndrome. This percentage might be higher if the more recent and stringent diagnostic criteria are used, but it is unlikely that more than 1 and 2% of patients with mitral valvar prolapse have an associated connective tissue disorder.Reference Weyman and Scherrer-Crosbie14 Marfan syndrome is associated with mutations in fibrillin-1 gene on chromosome 15q21.1.Reference Robinson, Arteaga-Solis and Baldock8 Because mitral valvar prolapse is found in many, but certainly not all patients with Marfan syndrome, it was suggested that isolated mitral valvar prolapse may also be because of a mutation of fibrillin-1 gene. However, despite the availability of millions of patients for study no convincing association has been found to date.Reference Weyman and Scherrer-Crosbie14 Since familial mitral valvar prolapse and Marfan syndrome are transmitted to future generations by autosomal dominant heritage, genetic inspections of mitral valvar prolapse, “genetic fibrillinopathies” or “type 1 fibrillinopathies”, are recently done especially over Marfan syndrome.Reference Loeys, Matthys and De Paepe9

In this study, a method of polymerase chain reaction- based restriction analysis was used to approach the single nucleotide polymorphism. In this case-controlled study, an association was found between fibrillin-1 gene intron 56 polymorphism and mitral valvar prolapse. The pathogenesis of elastic fibre abnormality in mitral valvar prolapse might be partially explained by this finding. Fibrillin-1 gene was evaluated in terms of intron 56 polymorphism and it was found that individuals with intron 56 heterozygote genotype are under higher risk of mitral valvar prolapse. Distribution of intron 56 homozygote and heterozygote genotypes in mitral valvar prolapse, and control groups is given in Table 2. The role of fibrillin-1 gene was hypothesised to be involved in the pathogenesis of isolated mitral valvar prolapse. A statistically significant difference in terms of intron 56 polymorphism was found between groups (p = 0.0001). In mitral valvar prolapse group, intron 56 heterozygote genotype was found to be statistically higher than that in controls. As a result, it was found that mitral valvar prolapse is more frequent in individuals with intron 56 heterozygote genotype and individuals with intron 56 homozygote genotype are under lower risk of mitral valvar prolapse. Allelic frequencies in terms of intron 56 polymorphism using Hardy–Weinberg method are also given in Table 2 and a statistical difference was determined between groups (p = 0.0001). Risk of mitral valvar prolapse was seen to increase with increasing G-allele frequency in intron 56 polymorphism.

A recent study reported that fibrillin-1 gene exons 15 and 27 polymorphisms were associated with an increase risk of mitral valvar prolapse in Chinese adults.Reference Chou, Shi, Hsu and Tsai15 In this study, it was reported that association between fibrillin-1 gene intron 56 polymorphism and mitral valvar prolapse in Turkish children. The current sample of 166 individuals is quite small in terms of genetic epidemiological studies. Although all people were of Turkish ethnicity and lived in the central Turkey, they could still be a certain ancestry prone to develop mitral valvar prolapse and the fibrillin-1 genotype is a mere marker for such a different population.

Mitral valvar prolapse is a common clinical phenotype. Its aetiology has not been elucidated yet. The scientific community has made significant efforts in identifying genetic profiles related to mitral valvar prolapse, especially through the use of linkage analysis. This resulted in the discovery of four different loci linked to mitral valvar prolapse on chromosomes 11, 13, 16, and X.Reference Disse, Abergel and Berrebi3Reference Nesta, Leyne and Yosefy5, Reference Kyndt, Schott and Trochu13 Currently, no set of specific genes has been identified. Elucidating the genetic basis for mitral valvar prolapse using well-designed case control or family-based studies may have substantial implications in clinical practice. This study shows that patients with mitral valvar prolapse have a higher frequency of fibrillin-1 gene intron 56 GC genotype and G-allele that supports a role of fibrillin-1 gene intron 56 polymorphism in determining the risk of mitral valvar prolapse among the Turkish children. Therefore, the study indicates the association between fibrillin-1 gene intron 56 polymorphism and mitral valvar prolapse and further investigation is required on this issue.

Footnotes

*

There is no financial support or relationships that may pose conflict of interest.

References

1.Boudoulas, H, Sparks, E, Wooley, CF. The floppy mitral valve, mitral valve prolapse, and mitral valvular regurgitation. In: Allen HD, Driscoll DJ, Shaddy RE, Feltes TF (eds). Moss and Adams’ Heart Disease in Infants, Children, and Adolescents: Including the Fetus and Young Adult, Vol. 2, 7th edition. Lippincott Williams & Wilkins, Philadelphia, 2008, pp 946968.Google Scholar
2.Freed, LA, Levy, D, Levine, RA, et al. Prevalence and clinical outcome of mitral valve prolapse. N Eng J Med 1999; 341: 17.CrossRefGoogle ScholarPubMed
3.Disse, S, Abergel, E, Berrebi, A, et al. Mapping of a first locus for autosomal dominant myxomatous mitral-valve prolapse to chromosome 16p11.2-p12.1. Am J Hum Genet 1999; 65: 12421251.CrossRefGoogle ScholarPubMed
4.Freed, LA, Acierno, JS, Dai, D, et al. A locus for autosomal dominant mitral valve prolapse on chromosome 11p15.4. Am J Hum Genet 2003; 72: 15511559.CrossRefGoogle ScholarPubMed
5.Nesta, F, Leyne, M, Yosefy, C, et al. New locus for autosomal dominant mitral valve prolapse on chromosome 13: clinical insights from genetic studies. Circulation 2005; 112: 20222030.CrossRefGoogle ScholarPubMed
6.Glesby, MJ, Pyeritz, RE. Association of mitral valve prolapse and systemic abnormalities of connective tissue. A phenotypic continuum. JAMA 1989; 262: 523528.CrossRefGoogle ScholarPubMed
7.Tamura, K, Fukuda, Y, Ishizaki, M, Masuda, Y, Yamanaka, N, Ferrans, VJ. Abnormalities in elastic fibers and other connective-tissue components of floppy mitral valve. Am Heart J 1995; 129: 11491158.CrossRefGoogle ScholarPubMed
8.Robinson, PN, Arteaga-Solis, E, Baldock, C, et al. The molecular genetics of Marfan syndrome and related disorders. J Med Genet 2006; 43: 769787.CrossRefGoogle ScholarPubMed
9.Loeys, BL, Matthys, DM, De Paepe, AMD. Genetic fibrillinopathies: new insights in molecular diagnosis and clinical management. Acta Clinica Belgica 2002; 58: 233241.Google Scholar
10.Freed, LA, Benjamin, EJ, Levy, D, et al. Mitral valve prolapse in the general population: the benign nature of echocardiographic features in the Framingham Heart Study. J Am Coll Cardiol 2002; 40: 12981304.CrossRefGoogle ScholarPubMed
11.Mechleb, BK, Kasasbeh, ES, Iskandar, SB, Schoondyke, JW, Garcia, ID. Mitral valve prolapse: relationship of echocardiography characteristics to natural history. Echocardiography 2006; 23: 434437.CrossRefGoogle ScholarPubMed
12.Edwards, WD. Cardiac anatomy and examination of cardiac specimens. In: Allen HD, Driscoll DJ, Shaddy RE, Feltes TF (eds). Moss and Adams’ Heart Disease in Infants, Children, and Adolescents: Including the Fetus and Young Adult, Vol. 1, 7th edition. Lippincott Williams & Wilkins, Philadelphia, 2008, pp 234.Google Scholar
13.Kyndt, F, Schott, JJ, Trochu, JN, et al. Mapping of X-linked myxomatous valvular dystrophy to chromosome Xq28. Am J Hum Genet 1998; 62: 627632.CrossRefGoogle ScholarPubMed
14.Weyman, AE, Scherrer-Crosbie, M. Marfan syndrome and mitral valve prolapse. J Clin Invest 2004; 114: 15431546.CrossRefGoogle ScholarPubMed
15.Chou, HT, Shi, YR, Hsu, Y, Tsai, FJ. Association between fibrillin 1 gene exon 15 and 27 polymorphisms and risk of mitral valve prolapse. J Heart Valve Dis 2003; 12: 475481.Google ScholarPubMed
Figure 0

Table 1 Gender and age distributions of patients with mitral valve prolapse and control groups.

Figure 1

Figure 1 Photograph of intron 56 taken with the camera including Syngene system.

Figure 2

Table 2 Distribution of fibrillin-1 gene intron 56 polymorphism in patients with mitral valve prolapse and healthy control subjects.